Incidental Mutation 'R9264:Polr3a'
ID 702443
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC1, 9330175N20Rik, RPC155
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9264 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 24448696-24487058 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24470831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 587 (T587A)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably benign
Transcript: ENSMUST00000026322
AA Change: T587A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: T587A

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
AA Change: T587A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,116,466 M1L probably benign Het
Abca15 A T 7: 120,401,833 I1531L probably benign Het
Adam28 T C 14: 68,607,465 Y791C probably benign Het
Ankrd40 T A 11: 94,338,361 I262N probably damaging Het
BC067074 G A 13: 113,319,480 V687M Het
Catsperg2 A T 7: 29,698,188 N1033K possibly damaging Het
Cdh10 A T 15: 18,963,995 D81V probably damaging Het
Cep290 T C 10: 100,498,016 V310A possibly damaging Het
Cep78 T C 19: 15,974,466 Y325C probably damaging Het
Clstn3 T A 6: 124,459,768 D197V probably damaging Het
Col11a1 T C 3: 114,212,160 I1647T unknown Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
Cyp4a10 T C 4: 115,524,278 S180P probably benign Het
D630045J12Rik T C 6: 38,158,238 I1336V probably benign Het
Dchs2 G A 3: 83,270,477 V946M probably damaging Het
Dnah10 A G 5: 124,736,836 R347G probably damaging Het
Dnah11 T A 12: 118,027,527 D2368V probably damaging Het
Ganab T C 19: 8,912,864 I719T possibly damaging Het
Gm10944 C A 10: 10,681,839 A11D unknown Het
Gmcl1 T C 6: 86,714,213 M267V probably benign Het
Inhbe T A 10: 127,350,558 D251V probably damaging Het
Kcnj1 G A 9: 32,396,358 R26Q probably benign Het
Lama5 A G 2: 180,196,478 probably benign Het
Lin9 T A 1: 180,667,347 D251E probably damaging Het
Magel2 T A 7: 62,378,596 I416N possibly damaging Het
Mdga2 T C 12: 66,513,283 N772S probably damaging Het
Msh3 G T 13: 92,349,304 Q171K probably benign Het
Mslnl T G 17: 25,742,532 probably benign Het
Mtpn A G 6: 35,512,241 L116P possibly damaging Het
Myh7 T C 14: 54,975,997 T1351A probably benign Het
Nectin3 A T 16: 46,454,635 I353N probably damaging Het
Nprl3 A T 11: 32,233,948 N500K probably benign Het
Nup93 T A 8: 94,292,720 I181N probably benign Het
Olfr1198 T C 2: 88,746,432 H152R probably damaging Het
Olfr362 G A 2: 37,104,789 T287I probably damaging Het
Optc T C 1: 133,905,240 I41V probably benign Het
Pcdh7 C A 5: 58,129,321 N1246K probably benign Het
Pcdhb3 T A 18: 37,302,113 D377E probably benign Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Pramel1 T G 4: 143,398,529 L341R probably damaging Het
Rhot2 A T 17: 25,841,766 N210K probably damaging Het
Slc37a1 A G 17: 31,300,485 I12V probably benign Het
Spata48 T A 11: 11,464,678 D141E Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
Ssx2ip T C 3: 146,437,200 V511A probably benign Het
Stfa1 G A 16: 36,280,568 V57I unknown Het
Syne1 T G 10: 5,262,793 R3265S probably damaging Het
Tacc2 G T 7: 130,626,803 K1739N probably damaging Het
Tas2r143 A T 6: 42,400,739 M168L probably benign Het
Tm4sf1 A T 3: 57,294,610 probably null Het
Ttc16 A G 2: 32,763,005 I604T possibly damaging Het
Ugt1a10 T A 1: 88,055,671 W64R possibly damaging Het
Usp34 A T 11: 23,489,064 H3561L Het
Vasp C T 7: 19,259,451 V276I unknown Het
Vwa3a A G 7: 120,775,464 N333S probably benign Het
Wipf3 A G 6: 54,483,881 N105D probably benign Het
Zfp760 T C 17: 21,723,682 S613P possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
R8753:Polr3a UTSW 14 24463634 nonsense probably null
R8785:Polr3a UTSW 14 24452315 missense probably benign 0.06
R8848:Polr3a UTSW 14 24450766 missense probably damaging 1.00
R9025:Polr3a UTSW 14 24469411 missense probably damaging 1.00
R9139:Polr3a UTSW 14 24469348 missense probably damaging 1.00
R9309:Polr3a UTSW 14 24459999 missense probably benign
R9363:Polr3a UTSW 14 24450763 missense probably damaging 1.00
R9526:Polr3a UTSW 14 24453245 missense probably benign 0.00
R9585:Polr3a UTSW 14 24452221 missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACACTGAAGATCTGCTTTCCG -3'
(R):5'- TCTGGGAAGCAGACCTGAAG -3'

Sequencing Primer
(F):5'- AAGATCTGCTTTCCGGTCCACAG -3'
(R):5'- TTTAACGTGTGTGTGTTCCCC -3'
Posted On 2022-03-25