Incidental Mutation 'R1644:Polr3a'
ID173776
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission 039680-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1644 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24470624 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 607 (P607S)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: P607S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: P607S

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223718
AA Change: P607S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225526
Meta Mutation Damage Score 0.1649 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,414,590 R8* probably null Het
Acacb A T 5: 114,195,285 H490L probably damaging Het
Ace C A 11: 105,985,106 H417N probably damaging Het
Adamtsl3 A G 7: 82,450,090 N151D possibly damaging Het
Agap1 A G 1: 89,663,730 N114S probably damaging Het
Arap3 A T 18: 37,984,245 V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 I8N probably benign Het
Arhgef17 A T 7: 100,929,504 F746I probably damaging Het
Atp6v0a1 T C 11: 101,038,786 S471P possibly damaging Het
Bdp1 A G 13: 100,060,940 V979A probably benign Het
Ccdc88c C A 12: 100,913,474 R1789L probably damaging Het
Cckar A T 5: 53,699,873 N327K probably benign Het
Cfap65 T C 1: 74,917,175 T1082A probably damaging Het
Clcn7 T A 17: 25,159,698 I719N probably damaging Het
Col27a1 C G 4: 63,328,631 probably benign Het
Cspp1 C T 1: 10,126,438 T179I probably damaging Het
Dnah1 C T 14: 31,302,292 probably benign Het
Dnah6 A G 6: 73,155,296 V1141A probably benign Het
Dusp4 A G 8: 34,818,479 Y298C probably damaging Het
Efhc1 C A 1: 20,967,401 Y267* probably null Het
Eif2s1 T A 12: 78,866,521 probably null Het
Epo A G 5: 137,483,155 V169A possibly damaging Het
Esr1 A T 10: 5,001,380 Y586F probably benign Het
Fat2 T C 11: 55,287,783 T1484A possibly damaging Het
Fat2 T C 11: 55,296,181 T1280A possibly damaging Het
Gm5828 T C 1: 16,769,261 noncoding transcript Het
Idh3b T C 2: 130,281,510 I187V possibly damaging Het
Kif13a A C 13: 46,793,922 V862G probably benign Het
Kndc1 A G 7: 139,930,756 D1327G probably damaging Het
Mfsd9 T A 1: 40,773,798 R452S probably benign Het
Myh15 C T 16: 49,132,203 R879C probably benign Het
Naip2 T C 13: 100,182,929 R260G possibly damaging Het
Npat T G 9: 53,570,172 L1060R probably damaging Het
Olfr1211 A T 2: 88,929,387 D309E probably benign Het
Olfr1261 A T 2: 89,993,953 T187S possibly damaging Het
Olfr169 T A 16: 19,566,406 H159L probably benign Het
Olfr523 T C 7: 140,176,648 V176A probably benign Het
Olfr667 A C 7: 104,916,808 F163V probably benign Het
Pld5 T C 1: 175,975,626 T296A possibly damaging Het
Polq C T 16: 37,060,264 A651V probably damaging Het
Ranbp9 G A 13: 43,412,539 R424C probably damaging Het
Rsl1 G A 13: 67,177,165 probably benign Het
Sema4c A G 1: 36,550,804 S490P probably damaging Het
Setd3 A T 12: 108,113,344 L300Q possibly damaging Het
Slc15a3 T C 19: 10,857,231 I492T possibly damaging Het
Stag1 T C 9: 100,880,900 probably benign Het
Tgm4 A G 9: 123,051,416 Y294C probably damaging Het
Tm9sf1 A G 14: 55,641,300 S212P probably benign Het
Tmcc1 A G 6: 116,133,865 S156P probably damaging Het
Vmn1r184 A C 7: 26,267,245 M139L probably benign Het
Vmn1r209 A C 13: 22,806,482 F13V possibly damaging Het
Xkr5 T C 8: 18,934,125 E467G probably benign Het
Zdbf2 C T 1: 63,308,972 S2170L possibly damaging Het
Zfp277 G T 12: 40,329,610 probably null Het
Zfp62 T C 11: 49,215,769 I229T probably damaging Het
Zfp810 A G 9: 22,279,028 S195P possibly damaging Het
Zfp94 G A 7: 24,311,502 probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGCCACCTAGAAGAACGGAGAC -3'
(R):5'- AGCCAAGGCTTGCCAGATCATC -3'

Sequencing Primer
(F):5'- CCTGGGCCTTTGTAGAAACAATG -3'
(R):5'- CCCTACAATACTAAAGGTGTGCTG -3'
Posted On2014-04-24