Mutagenetix > Incidental Mutation

Incidental Mutation 'R1644:Polr3a'

173776

Institutional Source

Beutler Lab

Gene Symbol

Polr3a

Ensembl Gene

ENSMUSG00000025280

Gene Name

polymerase (RNA) III (DNA directed) polypeptide A

Synonyms

RPC1, 9330175N20Rik, RPC155

MMRRC Submission

039680-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1644 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24448696-24487058 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24470624 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 607 (P607S)

Ref Sequence

ENSEMBL: ENSMUSP00000026322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]

AlphaFold

B2RXC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000026322
AA Change: P607S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: P607S

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000223718
AA Change: P607S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225526

Meta Mutation Damage Score

0.1649

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	T	1: 11,414,590	R8*	probably null	Het
Acacb	A	T	5: 114,195,285	H490L	probably damaging	Het
Ace	C	A	11: 105,985,106	H417N	probably damaging	Het
Adamtsl3	A	G	7: 82,450,090	N151D	possibly damaging	Het
Agap1	A	G	1: 89,663,730	N114S	probably damaging	Het
Arap3	A	T	18: 37,984,245	V926D	probably damaging	Het
Arhgap12	A	T	18: 6,112,340	I8N	probably benign	Het
Arhgef17	A	T	7: 100,929,504	F746I	probably damaging	Het
Atp6v0a1	T	C	11: 101,038,786	S471P	possibly damaging	Het
Bdp1	A	G	13: 100,060,940	V979A	probably benign	Het
Ccdc88c	C	A	12: 100,913,474	R1789L	probably damaging	Het
Cckar	A	T	5: 53,699,873	N327K	probably benign	Het
Cfap65	T	C	1: 74,917,175	T1082A	probably damaging	Het
Clcn7	T	A	17: 25,159,698	I719N	probably damaging	Het
Col27a1	C	G	4: 63,328,631		probably benign	Het
Cspp1	C	T	1: 10,126,438	T179I	probably damaging	Het
Dnah1	C	T	14: 31,302,292		probably benign	Het
Dnah6	A	G	6: 73,155,296	V1141A	probably benign	Het
Dusp4	A	G	8: 34,818,479	Y298C	probably damaging	Het
Efhc1	C	A	1: 20,967,401	Y267*	probably null	Het
Eif2s1	T	A	12: 78,866,521		probably null	Het
Epo	A	G	5: 137,483,155	V169A	possibly damaging	Het
Esr1	A	T	10: 5,001,380	Y586F	probably benign	Het
Fat2	T	C	11: 55,287,783	T1484A	possibly damaging	Het
Fat2	T	C	11: 55,296,181	T1280A	possibly damaging	Het
Gm5828	T	C	1: 16,769,261		noncoding transcript	Het
Idh3b	T	C	2: 130,281,510	I187V	possibly damaging	Het
Kif13a	A	C	13: 46,793,922	V862G	probably benign	Het
Kndc1	A	G	7: 139,930,756	D1327G	probably damaging	Het
Mfsd9	T	A	1: 40,773,798	R452S	probably benign	Het
Myh15	C	T	16: 49,132,203	R879C	probably benign	Het
Naip2	T	C	13: 100,182,929	R260G	possibly damaging	Het
Npat	T	G	9: 53,570,172	L1060R	probably damaging	Het
Olfr1211	A	T	2: 88,929,387	D309E	probably benign	Het
Olfr1261	A	T	2: 89,993,953	T187S	possibly damaging	Het
Olfr169	T	A	16: 19,566,406	H159L	probably benign	Het
Olfr523	T	C	7: 140,176,648	V176A	probably benign	Het
Olfr667	A	C	7: 104,916,808	F163V	probably benign	Het
Pld5	T	C	1: 175,975,626	T296A	possibly damaging	Het
Polq	C	T	16: 37,060,264	A651V	probably damaging	Het
Ranbp9	G	A	13: 43,412,539	R424C	probably damaging	Het
Rsl1	G	A	13: 67,177,165		probably benign	Het
Sema4c	A	G	1: 36,550,804	S490P	probably damaging	Het
Setd3	A	T	12: 108,113,344	L300Q	possibly damaging	Het
Slc15a3	T	C	19: 10,857,231	I492T	possibly damaging	Het
Stag1	T	C	9: 100,880,900		probably benign	Het
Tgm4	A	G	9: 123,051,416	Y294C	probably damaging	Het
Tm9sf1	A	G	14: 55,641,300	S212P	probably benign	Het
Tmcc1	A	G	6: 116,133,865	S156P	probably damaging	Het
Vmn1r184	A	C	7: 26,267,245	M139L	probably benign	Het
Vmn1r209	A	C	13: 22,806,482	F13V	possibly damaging	Het
Xkr5	T	C	8: 18,934,125	E467G	probably benign	Het
Zdbf2	C	T	1: 63,308,972	S2170L	possibly damaging	Het
Zfp277	G	T	12: 40,329,610		probably null	Het
Zfp62	T	C	11: 49,215,769	I229T	probably damaging	Het
Zfp810	A	G	9: 22,279,028	S195P	possibly damaging	Het
Zfp94	G	A	7: 24,311,502		probably benign	Het

Other mutations in Polr3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Polr3a	APN	14	24475863	missense	probably benign	0.35
IGL00974:Polr3a	APN	14	24479424	missense	probably benign	0.05
IGL01348:Polr3a	APN	14	24461763	missense	probably damaging	1.00
IGL01464:Polr3a	APN	14	24470681	splice site	probably benign
IGL01785:Polr3a	APN	14	24484120	nonsense	probably null
IGL01786:Polr3a	APN	14	24484120	nonsense	probably null
IGL01936:Polr3a	APN	14	24479188	missense	probably damaging	1.00
IGL02095:Polr3a	APN	14	24454610	missense	possibly damaging	0.91
IGL02454:Polr3a	APN	14	24475823	missense	possibly damaging	0.87
IGL02702:Polr3a	APN	14	24470877	missense	probably benign	0.07
IGL02961:Polr3a	APN	14	24467040	nonsense	probably null
IGL03069:Polr3a	APN	14	24461740	missense	probably damaging	0.99
R0001:Polr3a	UTSW	14	24452189	splice site	probably benign
R0048:Polr3a	UTSW	14	24469255	splice site	probably benign
R0157:Polr3a	UTSW	14	24479186	missense	probably damaging	0.99
R0445:Polr3a	UTSW	14	24454921	missense	probably benign	0.00
R0449:Polr3a	UTSW	14	24484466	missense	probably damaging	0.99
R0597:Polr3a	UTSW	14	24484134	missense	probably benign	0.29
R0604:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0644:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0703:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0754:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0767:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0816:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0817:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0819:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0840:Polr3a	UTSW	14	24452200	missense	possibly damaging	0.95
R1481:Polr3a	UTSW	14	24452548	missense	probably null	0.98
R1699:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R1704:Polr3a	UTSW	14	24484120	nonsense	probably null
R2363:Polr3a	UTSW	14	24475892	splice site	probably null
R3419:Polr3a	UTSW	14	24467035	missense	probably damaging	1.00
R3934:Polr3a	UTSW	14	24476101	missense	probably benign	0.30
R4296:Polr3a	UTSW	14	24453196	missense	possibly damaging	0.82
R4611:Polr3a	UTSW	14	24452508	splice site	probably null
R4690:Polr3a	UTSW	14	24464281	missense	possibly damaging	0.78
R4934:Polr3a	UTSW	14	24452624	missense	probably benign	0.11
R4947:Polr3a	UTSW	14	24482464	missense	probably benign	0.00
R5232:Polr3a	UTSW	14	24453211	missense	probably benign	0.00
R5263:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5264:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5265:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5282:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5319:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5321:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5323:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5387:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5388:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5401:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5402:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5443:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5444:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5725:Polr3a	UTSW	14	24465387	splice site	probably null
R5841:Polr3a	UTSW	14	24450698	missense	probably benign	0.00
R6408:Polr3a	UTSW	14	24486871	critical splice donor site	probably null
R6704:Polr3a	UTSW	14	24461842	missense	probably damaging	1.00
R7136:Polr3a	UTSW	14	24461815	missense	probably damaging	1.00
R7307:Polr3a	UTSW	14	24459987	missense	probably benign	0.03
R7368:Polr3a	UTSW	14	24467076	missense	probably damaging	0.98
R7800:Polr3a	UTSW	14	24484387	missense	probably null	0.83
R8753:Polr3a	UTSW	14	24463634	nonsense	probably null
R8785:Polr3a	UTSW	14	24452315	missense	probably benign	0.06
R8848:Polr3a	UTSW	14	24450766	missense	probably damaging	1.00
R9025:Polr3a	UTSW	14	24469411	missense	probably damaging	1.00
R9139:Polr3a	UTSW	14	24469348	missense	probably damaging	1.00
R9264:Polr3a	UTSW	14	24470831	missense	probably benign
R9309:Polr3a	UTSW	14	24459999	missense	probably benign
R9363:Polr3a	UTSW	14	24450763	missense	probably damaging	1.00
R9526:Polr3a	UTSW	14	24453245	missense	probably benign	0.00
R9585:Polr3a	UTSW	14	24452221	missense	probably damaging	1.00
Z1088:Polr3a	UTSW	14	24479724	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCTGCCACCTAGAAGAACGGAGAC -3'
(R):5'- AGCCAAGGCTTGCCAGATCATC -3'

Sequencing Primer
(F):5'- CCTGGGCCTTTGTAGAAACAATG -3'
(R):5'- CCCTACAATACTAAAGGTGTGCTG -3'

Posted On

2014-04-24