Mutagenetix > Incidental Mutation

Incidental Mutation 'R9620:Sptbn2'

724754

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9620 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4711208-4752353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4750507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 2250 (L2250P)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]

AlphaFold

Q68FG2

Predicted Effect

probably damaging
Transcript: ENSMUST00000008991
AA Change: L2250P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: L2250P

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178353

SMART Domains

Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

Domain	Start	End	E-Value	Type
RRM	2	69	1.96e-17	SMART
Pfam:RRM_1	81	118	5.6e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630095E13Rik	A	G	9: 36,637,202		probably null	Het
Abhd3	G	T	18: 10,704,605	T151K	possibly damaging	Het
Acsf2	C	T	11: 94,572,586	W130*	probably null	Het
Aldh16a1	G	A	7: 45,147,989	R132*	probably null	Het
Amer3	C	T	1: 34,588,962	P761S	probably benign	Het
Amotl1	G	T	9: 14,548,673	D886E	probably damaging	Het
Cacna1s	T	C	1: 136,108,171	F1383S	probably damaging	Het
Casc4	T	C	2: 121,906,761	V261A	probably benign	Het
Col14a1	T	A	15: 55,362,385	V148E	unknown	Het
Col9a2	T	A	4: 121,053,206		probably null	Het
Cyp2a5	T	A	7: 26,837,211	M205K	possibly damaging	Het
Dcst2	A	T	3: 89,370,518	Q466L	possibly damaging	Het
Ecel1	T	C	1: 87,153,131	I350V	possibly damaging	Het
Enthd1	G	A	15: 80,452,700	T511I	probably benign	Het
Exoc6b	T	A	6: 85,011,320	K92*	probably null	Het
Fam181a	T	G	12: 103,316,332	Y165*	probably null	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Fam71d	A	C	12: 78,715,303	D247A	probably damaging	Het
Fbxo34	A	G	14: 47,531,268	Y746C	probably damaging	Het
Fgfr4	T	A	13: 55,161,181	S372T	possibly damaging	Het
Fmo1	A	G	1: 162,833,821	F298L	probably benign	Het
Gad1	A	C	2: 70,574,276	D170A	possibly damaging	Het
Golgb1	T	C	16: 36,919,449	S2758P	probably benign	Het
H2afv	A	T	11: 6,429,094		probably null	Het
Ilkap	A	G	1: 91,376,251	C163R		Het
Krt9	A	T	11: 100,188,360	D735E	unknown	Het
Lipo3	A	T	19: 33,582,229	C80*	probably null	Het
Lpcat3	C	T	6: 124,703,580	P478L	probably damaging	Het
Luc7l3	G	A	11: 94,321,719	R24C	unknown	Het
Mafa	T	A	15: 75,747,312	H204L	probably benign	Het
Mapk10	A	C	5: 102,966,607	V305G	probably damaging	Het
Mgat1	T	C	11: 49,261,295	F202L	probably benign	Het
Micalcl	A	T	7: 112,381,196	T126S	probably benign	Het
Mill1	G	A	7: 18,263,102	R206H	probably benign	Het
Nlrc5	A	T	8: 94,476,406	Y378F	probably benign	Het
Nlrp9a	G	T	7: 26,551,044	R78L	probably damaging	Het
Olfr1358	G	T	10: 78,520,294	A229S	probably benign	Het
Olfr150	A	T	9: 39,736,991	M59L		Het
Olfr556	A	T	7: 102,670,804	I295F	possibly damaging	Het
Orc6	A	T	8: 85,299,801		probably benign	Het
Pcdhgb5	C	T	18: 37,731,433	Q94*	probably null	Het
Pcnx	A	G	12: 81,950,186	D952G	probably damaging	Het
Ppfia2	A	T	10: 106,913,658	H1135L		Het
Prmt2	A	T	10: 76,225,379	I91N	probably damaging	Het
Ptprm	A	G	17: 66,809,489	Y932H	probably damaging	Het
Qrich2	T	C	11: 116,447,120	K154R	probably damaging	Het
Rapgef4	A	G	2: 72,205,707	T515A	probably benign	Het
Rgmb	G	A	17: 15,821,017	R103*	probably null	Het
Ripk1	T	G	13: 34,026,823	S334A	possibly damaging	Het
Rnf5	C	T	17: 34,601,747	G147S	possibly damaging	Het
Ryr1	T	C	7: 29,015,713	Y4662C	unknown	Het
Secisbp2l	A	G	2: 125,747,474	M718T	probably damaging	Het
Slc16a6	T	C	11: 109,463,496	T100A	probably benign	Het
Slc27a6	T	A	18: 58,609,815	M525K	probably damaging	Het
Slco2a1	G	C	9: 103,084,866	C579S	probably damaging	Het
Snx14	A	G	9: 88,381,741	S864P	probably damaging	Het
Tlr6	A	T	5: 64,954,803	S254T	possibly damaging	Het
Trap1	A	T	16: 4,040,219	Y675*	probably null	Het
Ttc9b	C	A	7: 27,654,087	A54E	probably damaging	Het
Unc45a	A	C	7: 80,325,655	Y934D	probably damaging	Het
Usp17ld	A	G	7: 103,250,972	L251P	possibly damaging	Het
Usp42	A	G	5: 143,717,399	V489A	probably damaging	Het
Vars	A	G	17: 35,016,025	T1277A	unknown	Het
Vmn2r117	A	G	17: 23,478,476	S81P	probably damaging	Het
Vmn2r69	T	A	7: 85,412,296	I157F	probably benign	Het
Zfp697	A	G	3: 98,427,866	S316G	probably damaging	Het
Zfp729b	T	A	13: 67,591,668	H826L	probably damaging	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4724705	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4725938	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01373:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01420:Sptbn2	APN	19	4734125	missense	probably benign
IGL01456:Sptbn2	APN	19	4746749	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4749693	missense	probably benign
IGL03026:Sptbn2	APN	19	4724233	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4732661	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4747832	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4745577	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0121:Sptbn2	UTSW	19	4745293	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4724744	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4746942	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4745145	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4737926	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4745938	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4726690	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4739986	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4748123	nonsense	probably null
R0742:Sptbn2	UTSW	19	4718983	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4732665	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4718976	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4744246	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4750242	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4750497	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4745964	nonsense	probably null
R1820:Sptbn2	UTSW	19	4726596	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4732541	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4732685	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4745299	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4738559	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4734138	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4718935	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4748636	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4745922	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4738355	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4732602	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4739239	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4732496	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4742480	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4748154	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4729430	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4738469	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4729309	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4729202	splice site	probably null
R4981:Sptbn2	UTSW	19	4751658	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4737857	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4724184	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4750082	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4718908	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4750105	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4725950	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4748947	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4724667	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4738219	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4739278	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4731392	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4748138	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4724646	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4732496	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4742418	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4744180	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4747926	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4749814	missense	probably benign
R6703:Sptbn2	UTSW	19	4749815	missense	probably benign
R6753:Sptbn2	UTSW	19	4747785	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4744145	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4749460	missense	probably null
R7219:Sptbn2	UTSW	19	4724173	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4737443	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4751574	missense	probably benign
R7469:Sptbn2	UTSW	19	4745118	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4748082	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4726168	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4744207	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4724125	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4734143	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4744262	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4746799	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4737403	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4729130	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4746696	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4734213	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4739946	missense	probably damaging	1.00
R9631:Sptbn2	UTSW	19	4738190	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4745313	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4738205	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4745191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCTTCTGAAGAGGGTTTCC -3'
(R):5'- TCCTTCCATTCCAACCCGAGAG -3'

Sequencing Primer
(F):5'- ACTTCCTAGACAGAGAGGGG -3'
(R):5'- AGAGGAGCCCAGGTACCTAC -3'

Posted On

2022-09-12