Incidental Mutation 'R9620:Col9a2'
ID 724700
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9620 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 121039385-121055322 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 121053206 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000030372
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A G 9: 36,637,202 probably null Het
Abhd3 G T 18: 10,704,605 T151K possibly damaging Het
Acsf2 C T 11: 94,572,586 W130* probably null Het
Aldh16a1 G A 7: 45,147,989 R132* probably null Het
Amer3 C T 1: 34,588,962 P761S probably benign Het
Amotl1 G T 9: 14,548,673 D886E probably damaging Het
Cacna1s T C 1: 136,108,171 F1383S probably damaging Het
Casc4 T C 2: 121,906,761 V261A probably benign Het
Col14a1 T A 15: 55,362,385 V148E unknown Het
Cyp2a5 T A 7: 26,837,211 M205K possibly damaging Het
Dcst2 A T 3: 89,370,518 Q466L possibly damaging Het
Ecel1 T C 1: 87,153,131 I350V possibly damaging Het
Enthd1 G A 15: 80,452,700 T511I probably benign Het
Exoc6b T A 6: 85,011,320 K92* probably null Het
Fam181a T G 12: 103,316,332 Y165* probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71d A C 12: 78,715,303 D247A probably damaging Het
Fbxo34 A G 14: 47,531,268 Y746C probably damaging Het
Fgfr4 T A 13: 55,161,181 S372T possibly damaging Het
Fmo1 A G 1: 162,833,821 F298L probably benign Het
Gad1 A C 2: 70,574,276 D170A possibly damaging Het
Golgb1 T C 16: 36,919,449 S2758P probably benign Het
H2afv A T 11: 6,429,094 probably null Het
Ilkap A G 1: 91,376,251 C163R Het
Krt9 A T 11: 100,188,360 D735E unknown Het
Lipo3 A T 19: 33,582,229 C80* probably null Het
Lpcat3 C T 6: 124,703,580 P478L probably damaging Het
Luc7l3 G A 11: 94,321,719 R24C unknown Het
Mafa T A 15: 75,747,312 H204L probably benign Het
Mapk10 A C 5: 102,966,607 V305G probably damaging Het
Mgat1 T C 11: 49,261,295 F202L probably benign Het
Micalcl A T 7: 112,381,196 T126S probably benign Het
Mill1 G A 7: 18,263,102 R206H probably benign Het
Nlrc5 A T 8: 94,476,406 Y378F probably benign Het
Nlrp9a G T 7: 26,551,044 R78L probably damaging Het
Olfr1358 G T 10: 78,520,294 A229S probably benign Het
Olfr150 A T 9: 39,736,991 M59L Het
Olfr556 A T 7: 102,670,804 I295F possibly damaging Het
Orc6 A T 8: 85,299,801 probably benign Het
Pcdhgb5 C T 18: 37,731,433 Q94* probably null Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Ppfia2 A T 10: 106,913,658 H1135L Het
Prmt2 A T 10: 76,225,379 I91N probably damaging Het
Ptprm A G 17: 66,809,489 Y932H probably damaging Het
Qrich2 T C 11: 116,447,120 K154R probably damaging Het
Rapgef4 A G 2: 72,205,707 T515A probably benign Het
Rgmb G A 17: 15,821,017 R103* probably null Het
Ripk1 T G 13: 34,026,823 S334A possibly damaging Het
Rnf5 C T 17: 34,601,747 G147S possibly damaging Het
Ryr1 T C 7: 29,015,713 Y4662C unknown Het
Secisbp2l A G 2: 125,747,474 M718T probably damaging Het
Slc16a6 T C 11: 109,463,496 T100A probably benign Het
Slc27a6 T A 18: 58,609,815 M525K probably damaging Het
Slco2a1 G C 9: 103,084,866 C579S probably damaging Het
Snx14 A G 9: 88,381,741 S864P probably damaging Het
Sptbn2 T C 19: 4,750,507 L2250P probably damaging Het
Tlr6 A T 5: 64,954,803 S254T possibly damaging Het
Trap1 A T 16: 4,040,219 Y675* probably null Het
Ttc9b C A 7: 27,654,087 A54E probably damaging Het
Unc45a A C 7: 80,325,655 Y934D probably damaging Het
Usp17ld A G 7: 103,250,972 L251P possibly damaging Het
Usp42 A G 5: 143,717,399 V489A probably damaging Het
Vars A G 17: 35,016,025 T1277A unknown Het
Vmn2r117 A G 17: 23,478,476 S81P probably damaging Het
Vmn2r69 T A 7: 85,412,296 I157F probably benign Het
Zfp697 A G 3: 98,427,866 S316G probably damaging Het
Zfp729b T A 13: 67,591,668 H826L probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
collision UTSW 4 121049716 critical splice donor site probably null
gravity_wave UTSW 4 121044019 critical splice donor site probably null
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
R9120:Col9a2 UTSW 4 121043754 splice site probably benign
R9341:Col9a2 UTSW 4 121054286 missense probably benign 0.03
R9343:Col9a2 UTSW 4 121054286 missense probably benign 0.03
R9389:Col9a2 UTSW 4 121054751 missense probably benign 0.00
R9527:Col9a2 UTSW 4 121042331 critical splice donor site probably null
R9784:Col9a2 UTSW 4 121041029 missense unknown
Z1176:Col9a2 UTSW 4 121053797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAAGCCTTCTCAGTCCAC -3'
(R):5'- CAATTCAGGAAGAAGCTCTGGC -3'

Sequencing Primer
(F):5'- AGTCCACACCGTCCCCTG -3'
(R):5'- TCTGGCTGCCAAGACCAAC -3'
Posted On 2022-09-12