Incidental Mutation 'R0834:Helz2'
ID77708
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181230777 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2477 (S2477P)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: S2521P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: S2521P

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: S2521P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: S2521P

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: S2477P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: S2477P

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Meta Mutation Damage Score 0.3627 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dhcr7 A G 7: 143,841,227 N157S probably benign Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Frem3 A G 8: 80,687,008 Y1966C probably damaging Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kalrn A C 16: 34,049,919 S160A possibly damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Ndufb10 T C 17: 24,722,674 M90V probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Parg T C 14: 32,214,554 probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Strn3 A G 12: 51,627,096 probably benign Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
R7372:Helz2 UTSW 2 181238423 missense possibly damaging 0.61
R7512:Helz2 UTSW 2 181230854 missense probably benign 0.00
R7512:Helz2 UTSW 2 181235600 splice site probably null
R7583:Helz2 UTSW 2 181237572 missense probably benign 0.06
R7724:Helz2 UTSW 2 181231996 missense probably damaging 1.00
R7733:Helz2 UTSW 2 181230355 missense possibly damaging 0.63
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACAGACTCCTGTTGCTCACTCC -3'
(R):5'- CCCTGCTGGACATCATAAGCTGAAC -3'

Sequencing Primer
(F):5'- TGCTCACTCCTGGCAGC -3'
(R):5'- CAGTTCACAGTCATCCAGGG -3'
Posted On2013-10-16