Incidental Mutation 'R0927:Thap1'
ID80509
Institutional Source Beutler Lab
Gene Symbol Thap1
Ensembl Gene ENSMUSG00000037214
Gene NameTHAP domain containing, apoptosis associated protein 1
Synonyms4833431A01Rik
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location26158141-26164151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26162705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 157 (V157A)
Ref Sequence ENSEMBL: ENSMUSP00000121153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036807] [ENSMUST00000130231] [ENSMUST00000131138]
Predicted Effect probably benign
Transcript: ENSMUST00000036807
AA Change: V180A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042464
Gene: ENSMUSG00000037214
AA Change: V180A

DomainStartEndE-ValueType
THAP 3 86 6.6e-20 SMART
DM3 22 86 3.01e-16 SMART
low complexity region 93 108 N/A INTRINSIC
coiled coil region 137 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127536
Predicted Effect probably benign
Transcript: ENSMUST00000130231
AA Change: V157A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121153
Gene: ENSMUSG00000037214
AA Change: V157A

DomainStartEndE-ValueType
DM3 2 63 1.13e-11 SMART
THAP 2 63 6.77e-8 SMART
low complexity region 70 85 N/A INTRINSIC
SCOP:d1lxa__ 121 173 8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131138
SMART Domains Protein: ENSMUSP00000115452
Gene: ENSMUSG00000109850

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209926
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO is embryonic lethal. Heterozygous KO affects motor control and the morphology of the cerebellum dentate nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Thap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Thap1 APN 8 26160882 missense possibly damaging 0.74
IGL00990:Thap1 APN 8 26162731 missense probably benign 0.21
IGL02491:Thap1 APN 8 26160857 missense probably damaging 0.97
IGL03097:Thap1 UTSW 8 26162470 missense probably benign
IGL03098:Thap1 UTSW 8 26162470 missense probably benign
R0755:Thap1 UTSW 8 26158473 missense probably damaging 1.00
R4645:Thap1 UTSW 8 26162569 missense probably damaging 1.00
R4661:Thap1 UTSW 8 26160846 missense probably benign 0.04
R4803:Thap1 UTSW 8 26160854 frame shift probably null
R4978:Thap1 UTSW 8 26160854 frame shift probably null
R6424:Thap1 UTSW 8 26160856 frame shift probably null
R6447:Thap1 UTSW 8 26160856 frame shift probably null
R6503:Thap1 UTSW 8 26160856 frame shift probably null
R6995:Thap1 UTSW 8 26162651 missense probably damaging 1.00
R7169:Thap1 UTSW 8 26160856 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTTCCCAGGTTGATGCTGCTATTG -3'
(R):5'- TGAAAGGCTCTGTCCTATGCTCTCAC -3'

Sequencing Primer
(F):5'- CTGCTATTGGGCTGCTAATGC -3'
(R):5'- GTCCTATGCTCTCACTTAAACATCTG -3'
Posted On2013-11-07