Incidental Mutation 'R1087:Dcaf11'
ID85089
Institutional Source Beutler Lab
Gene Symbol Dcaf11
Ensembl Gene ENSMUSG00000022214
Gene NameDDB1 and CUL4 associated factor 11
Synonyms0710008A13Rik, GLO14, D14Ucla1, Wdr23
Accession Numbers

Genbank: NM_133734; MGI: 90168

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55560006-55570065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55569124 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 461 (S461G)
Ref Sequence ENSEMBL: ENSMUSP00000113620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072530] [ENSMUST00000117236] [ENSMUST00000117701] [ENSMUST00000121622] [ENSMUST00000128490] [ENSMUST00000143375] [ENSMUST00000150019] [ENSMUST00000150481] [ENSMUST00000152681]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072530
AA Change: S501G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072344
Gene: ENSMUSG00000022214
AA Change: S501G

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117236
AA Change: S501G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113014
Gene: ENSMUSG00000022214
AA Change: S501G

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117701
AA Change: S461G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113620
Gene: ENSMUSG00000022214
AA Change: S461G

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WD40 122 160 8.91e-1 SMART
WD40 165 206 8.25e0 SMART
WD40 212 253 2.39e0 SMART
WD40 256 296 1.44e-5 SMART
WD40 304 343 1.26e-5 SMART
WD40 384 429 1.72e0 SMART
WD40 432 471 1.49e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121622
AA Change: S501G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113202
Gene: ENSMUSG00000022214
AA Change: S501G

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128490
AA Change: S501G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114211
Gene: ENSMUSG00000022214
AA Change: S501G

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135068
Predicted Effect probably benign
Transcript: ENSMUST00000143375
SMART Domains Protein: ENSMUSP00000121570
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145983
Predicted Effect probably benign
Transcript: ENSMUST00000150019
SMART Domains Protein: ENSMUSP00000117617
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150481
SMART Domains Protein: ENSMUSP00000119001
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152681
SMART Domains Protein: ENSMUSP00000120296
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155029
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Dcaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Dcaf11 APN 14 55561285 utr 5 prime probably benign
IGL02158:Dcaf11 APN 14 55564523 splice site probably null
IGL02487:Dcaf11 APN 14 55569114 missense probably benign 0.06
IGL02887:Dcaf11 APN 14 55564135 missense probably damaging 1.00
IGL03263:Dcaf11 APN 14 55565492 missense probably damaging 0.99
IGL03392:Dcaf11 APN 14 55561421 missense probably damaging 1.00
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0084:Dcaf11 UTSW 14 55569243 missense probably benign 0.00
R0110:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0450:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0510:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0662:Dcaf11 UTSW 14 55565507 missense possibly damaging 0.93
R2281:Dcaf11 UTSW 14 55569371 makesense probably null
R2698:Dcaf11 UTSW 14 55566885 missense probably damaging 1.00
R2866:Dcaf11 UTSW 14 55565745 missense possibly damaging 0.92
R4472:Dcaf11 UTSW 14 55565606 intron probably benign
R5288:Dcaf11 UTSW 14 55563376 missense probably damaging 1.00
R5682:Dcaf11 UTSW 14 55563426 missense probably damaging 1.00
R5706:Dcaf11 UTSW 14 55565695 missense probably damaging 1.00
R7133:Dcaf11 UTSW 14 55568926 splice site probably null
R7468:Dcaf11 UTSW 14 55565509 missense possibly damaging 0.70
R7673:Dcaf11 UTSW 14 55569305 missense probably benign 0.00
R8755:Dcaf11 UTSW 14 55560566 start gained probably benign
R8861:Dcaf11 UTSW 14 55564498 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCAGGCAGAGCACCATCTTC -3'
(R):5'- TTCTCACCCAGTGTGAGCAGTTCC -3'

Sequencing Primer
(F):5'- TGCTGCCTGAGAAGCAAGTC -3'
(R):5'- ACAGACTCTGTTCATGTCAGAC -3'
Posted On2013-11-18