Incidental Mutation 'R0980:Vmn1r170'
ID96987
Institutional Source Beutler Lab
Gene Symbol Vmn1r170
Ensembl Gene ENSMUSG00000094187
Gene Namevomeronasal 1 receptor 170
SynonymsGm5999
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23606175-23607089 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23606334 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 54 (I54F)
Ref Sequence ENSEMBL: ENSMUSP00000127655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170166
AA Change: I54F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127655
Gene: ENSMUSG00000094187
AA Change: I54F

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 1.8e-13 PFAM
Pfam:7tm_1 30 287 3.6e-6 PFAM
Pfam:V1R 42 295 1.4e-20 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Other mutations in Vmn1r170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Vmn1r170 APN 7 23606913 missense probably damaging 1.00
IGL02150:Vmn1r170 APN 7 23607040 nonsense probably null
IGL02216:Vmn1r170 APN 7 23606490 missense probably damaging 1.00
IGL02749:Vmn1r170 APN 7 23606291 missense probably benign 0.00
IGL02807:Vmn1r170 APN 7 23606335 missense probably damaging 1.00
IGL02828:Vmn1r170 APN 7 23606518 missense probably damaging 0.99
IGL02971:Vmn1r170 APN 7 23606334 missense possibly damaging 0.81
IGL03073:Vmn1r170 APN 7 23606848 missense probably damaging 1.00
IGL03151:Vmn1r170 APN 7 23606577 missense probably benign 0.35
R0079:Vmn1r170 UTSW 7 23606310 missense possibly damaging 0.95
R0266:Vmn1r170 UTSW 7 23606481 missense probably benign 0.00
R1345:Vmn1r170 UTSW 7 23606362 missense probably benign 0.00
R1620:Vmn1r170 UTSW 7 23606329 missense probably benign 0.30
R1713:Vmn1r170 UTSW 7 23606863 missense probably benign 0.30
R1745:Vmn1r170 UTSW 7 23606334 missense probably damaging 0.98
R1974:Vmn1r170 UTSW 7 23606481 missense probably benign 0.00
R2163:Vmn1r170 UTSW 7 23607037 missense probably damaging 1.00
R3812:Vmn1r170 UTSW 7 23606292 missense probably damaging 1.00
R4583:Vmn1r170 UTSW 7 23606662 missense probably benign 0.25
R5309:Vmn1r170 UTSW 7 23606455 missense probably damaging 0.97
R5378:Vmn1r170 UTSW 7 23606538 missense probably benign 0.00
R5379:Vmn1r170 UTSW 7 23606629 missense possibly damaging 0.81
R5661:Vmn1r170 UTSW 7 23606806 missense possibly damaging 0.82
R5673:Vmn1r170 UTSW 7 23606205 missense possibly damaging 0.58
R6181:Vmn1r170 UTSW 7 23606267 missense probably damaging 0.98
R6192:Vmn1r170 UTSW 7 23606509 missense probably damaging 1.00
R7467:Vmn1r170 UTSW 7 23606895 missense not run
R7667:Vmn1r170 UTSW 7 23607048 missense probably damaging 1.00
X0060:Vmn1r170 UTSW 7 23606943 missense possibly damaging 0.50
Z1176:Vmn1r170 UTSW 7 23606410 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCATGCAGATAAAGTAGAGCTGCCC -3'
(R):5'- TGTTTGTACTTCGAGCCACCAGCC -3'

Sequencing Primer
(F):5'- ATAAAGTAGAGCTGCCCTTCGTG -3'
(R):5'- GCCAAATGAAGTACCCAAGTTTAC -3'
Posted On2014-01-05