Incidental Mutation 'R1440:Sorbs2'
ID160933
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Namesorbin and SH3 domain containing 2
Synonyms
MMRRC Submission 039495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1440 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45507788-45827906 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 45789963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]
Predicted Effect probably benign
Transcript: ENSMUST00000067065
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067107
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125295
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect probably benign
Transcript: ENSMUST00000135336
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139869
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153798
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171337
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Predicted Effect probably benign
Transcript: ENSMUST00000155858
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211721
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.7%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T G 12: 72,881,421 N512T possibly damaging Het
Aadacl2 A T 3: 60,024,892 H276L probably damaging Het
Adam12 G A 7: 133,931,814 T445M probably benign Het
Ash2l A T 8: 25,827,378 F290L probably benign Het
Asxl3 C T 18: 22,525,224 P2097L probably benign Het
Atmin A G 8: 116,957,376 I592V probably damaging Het
Atxn2 T C 5: 121,803,082 probably null Het
BC004004 T C 17: 29,296,691 probably null Het
Cacna1e T C 1: 154,561,806 N328S possibly damaging Het
Cacna2d1 A T 5: 16,355,495 K765I probably damaging Het
Cc2d1a A G 8: 84,133,975 probably null Het
Ccdc28b A G 4: 129,620,615 V198A probably benign Het
Ces1b G T 8: 93,068,108 R288S probably damaging Het
Cfap100 T G 6: 90,412,184 T198P probably benign Het
Clint1 T C 11: 45,890,783 S227P probably damaging Het
Cntn5 C A 9: 10,145,339 C122F probably damaging Het
Col3a1 A G 1: 45,343,312 probably null Het
Cyp4a10 A C 4: 115,529,449 D431A probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dlc1 A T 8: 36,593,463 probably benign Het
Dlgap2 T C 8: 14,727,060 S102P probably benign Het
Dnah7b G A 1: 46,078,593 probably benign Het
Dock10 A C 1: 80,549,136 S1124A probably benign Het
Dscam C T 16: 96,819,951 R519H probably damaging Het
Efcab3 A T 11: 105,108,755 probably benign Het
Evi2a G T 11: 79,527,270 N171K probably damaging Het
Fbxl15 T C 19: 46,330,245 L286P probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Gcat C T 15: 79,033,994 A84V probably null Het
Gls A G 1: 52,191,134 F473L possibly damaging Het
Gnat1 T C 9: 107,676,965 D169G probably damaging Het
Grm3 A C 5: 9,589,958 M29R probably benign Het
Herc1 A T 9: 66,467,803 D3303V probably damaging Het
Ibsp G A 5: 104,310,539 G314D unknown Het
Lgr6 C A 1: 134,987,472 A513S probably damaging Het
Lrmp C T 6: 145,174,511 T484M possibly damaging Het
Lrriq4 T A 3: 30,650,761 C313S probably damaging Het
March10 G T 11: 105,390,583 T292K probably damaging Het
Mcoln2 C A 3: 146,190,382 Y6* probably null Het
Mup4 A G 4: 59,958,076 I164T probably damaging Het
Myo1b T C 1: 51,778,558 probably benign Het
Ncam1 A G 9: 49,544,800 I506T probably damaging Het
Notch1 A T 2: 26,480,964 probably benign Het
Nr4a3 A T 4: 48,051,777 Q177L probably benign Het
Nsun4 A G 4: 116,052,950 S138P possibly damaging Het
Olfr11 G T 13: 21,639,390 N44K probably benign Het
Olfr403 A G 11: 74,195,679 M59V probably damaging Het
Olfr716 A T 7: 107,148,198 N294I probably damaging Het
Olfr729 T C 14: 50,148,358 N172S probably damaging Het
Pagr1a A T 7: 127,016,297 probably benign Het
Pcdhb2 A T 18: 37,296,290 I82L probably benign Het
Pds5b A T 5: 150,754,417 N500I probably damaging Het
Pik3r6 A T 11: 68,531,445 E223D possibly damaging Het
Pkhd1l1 A T 15: 44,540,988 probably benign Het
Prex1 T C 2: 166,580,463 D1204G probably damaging Het
Prickle1 C T 15: 93,505,074 E244K possibly damaging Het
Ptprd A T 4: 76,084,552 V211E probably damaging Het
Rad51d G A 11: 82,890,353 R23* probably null Het
Rapgef6 G A 11: 54,626,708 G262R probably damaging Het
Reln A G 5: 22,128,602 probably benign Het
Rev1 T C 1: 38,088,205 T325A probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rp1 C A 1: 4,347,396 L1164F probably damaging Het
S100a7a T C 3: 90,655,635 V43A probably benign Het
Scaper A C 9: 55,602,918 Y1104* probably null Het
Scn2a T A 2: 65,764,594 V1929D probably benign Het
Scn3a T C 2: 65,529,441 N141S possibly damaging Het
Slc12a7 T G 13: 73,801,008 L718R probably damaging Het
Slc15a2 T C 16: 36,784,643 probably benign Het
Slc35b3 G A 13: 38,954,134 Q100* probably null Het
Slc9a5 T A 8: 105,355,153 V170E possibly damaging Het
Snx5 T G 2: 144,254,811 K278T possibly damaging Het
Stab1 C T 14: 31,151,690 W1008* probably null Het
Stab2 C T 10: 86,861,367 probably null Het
Tacc3 A G 5: 33,667,977 E377G probably benign Het
Tango6 T C 8: 106,689,039 L164P probably damaging Het
Tbc1d12 T A 19: 38,914,352 S570T possibly damaging Het
Thbs1 T C 2: 118,114,355 F217L probably damaging Het
Tmbim6 T A 15: 99,402,123 V40E probably damaging Het
Tmigd1 A T 11: 76,910,160 N158Y probably damaging Het
Top3b C T 16: 16,892,777 R824* probably null Het
Tram1l1 A T 3: 124,321,931 K247* probably null Het
Tsc2 T C 17: 24,614,392 Y686C probably damaging Het
Tsga10 T C 1: 37,819,599 Q218R probably damaging Het
Uba6 G T 5: 86,140,423 A439D probably damaging Het
Ubn1 C A 16: 5,077,294 P735T probably damaging Het
Usp40 A G 1: 87,982,086 S549P probably benign Het
Utp20 T C 10: 88,819,339 T176A probably benign Het
Utp4 T G 8: 106,898,053 probably benign Het
Xpo5 C T 17: 46,207,927 probably benign Het
Zfp979 A T 4: 147,614,036 I72K possibly damaging Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 45799706 splice site probably null
IGL00964:Sorbs2 APN 8 45795677 missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 45745423 missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 45795594 missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 45795344 missense probably null
IGL01662:Sorbs2 APN 8 45803829 splice site probably benign
IGL01970:Sorbs2 APN 8 45745803 missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 45823749 missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 45803840 missense probably benign 0.00
IGL03036:Sorbs2 APN 8 45782865 missense probably benign
IGL03151:Sorbs2 APN 8 45799713 missense probably benign 0.01
IGL03164:Sorbs2 APN 8 45782874 missense probably benign 0.01
IGL03350:Sorbs2 APN 8 45805807 missense probably damaging 0.99
BB001:Sorbs2 UTSW 8 45795470 missense probably damaging 1.00
BB011:Sorbs2 UTSW 8 45795470 missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 45785254 splice site probably null
R0058:Sorbs2 UTSW 8 45796263 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 45785337 splice site probably benign
R0306:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R0308:Sorbs2 UTSW 8 45795130 nonsense probably null
R0638:Sorbs2 UTSW 8 45796310 missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 45796502 missense probably benign 0.39
R1110:Sorbs2 UTSW 8 45795730 missense probably benign 0.13
R1160:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 45795619 missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 45795967 missense probably damaging 1.00
R1514:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 45759197 splice site probably benign
R1582:Sorbs2 UTSW 8 45805777 missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 45769854 missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 45800984 missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 45763019 makesense probably null
R1766:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 45805696 missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 45796352 missense probably benign 0.01
R1954:Sorbs2 UTSW 8 45745738 missense probably benign 0.23
R2060:Sorbs2 UTSW 8 45775629 missense probably damaging 1.00
R2149:Sorbs2 UTSW 8 45795443 missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 45795370 nonsense probably null
R3812:Sorbs2 UTSW 8 45763030 missense probably benign 0.00
R3831:Sorbs2 UTSW 8 45795095 missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 45772710 critical splice donor site probably null
R4033:Sorbs2 UTSW 8 45775595 missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 45795293 missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 45741615 intron probably benign
R4926:Sorbs2 UTSW 8 45796217 missense probably benign 0.03
R5027:Sorbs2 UTSW 8 45746534 splice site probably null
R5118:Sorbs2 UTSW 8 45795785 missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R5342:Sorbs2 UTSW 8 45796013 missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 45819741 missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 45796001 missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 45741581 critical splice donor site probably null
R5687:Sorbs2 UTSW 8 45775632 missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 45792875 missense probably benign 0.27
R5733:Sorbs2 UTSW 8 45759189 missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 45763183 missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 45769897 critical splice donor site probably null
R6341:Sorbs2 UTSW 8 45770578 missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 45796176 missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 45772614 missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 45795823 nonsense probably null
R7404:Sorbs2 UTSW 8 45759196 splice site probably null
R7524:Sorbs2 UTSW 8 45795656 missense probably benign 0.00
R7809:Sorbs2 UTSW 8 45745428 missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 45796556 missense probably null 0.16
R7924:Sorbs2 UTSW 8 45795470 missense probably damaging 1.00
R8285:Sorbs2 UTSW 8 45796067 missense probably damaging 0.98
Z1176:Sorbs2 UTSW 8 45790025 missense probably null 0.96
Z1177:Sorbs2 UTSW 8 45782959 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCTGAAGGCACCTTTGCCC -3'
(R):5'- TGATTGAATACACACCATGAGGCTTGG -3'

Sequencing Primer
(F):5'- TGCtgttttgttttttgtttgttttg -3'
(R):5'- GGCTTGGTACTTAAAATAAGAATGCG -3'
Posted On2014-03-14