Mutagenetix > Incidental Mutation

Incidental Mutation 'R1440:Sorbs2'

160933

Institutional Source

Beutler Lab

Gene Symbol

Sorbs2

Ensembl Gene

ENSMUSG00000031626

Gene Name

sorbin and SH3 domain containing 2

Synonyms

MMRRC Submission

039495-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1440 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45507788-45827906 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 45789963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000067065

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067107

SMART Domains

Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125295

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130011

SMART Domains

Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	113	163	1.01e-27	SMART
low complexity region	195	208	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	283	301	N/A	INTRINSIC
low complexity region	366	383	N/A	INTRINSIC
SH3	418	473	5.1e-23	SMART
low complexity region	474	489	N/A	INTRINSIC
SH3	493	550	3.9e-19	SMART
SH3	596	652	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132139

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135116

Predicted Effect

probably benign
Transcript: ENSMUST00000135336

SMART Domains

Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138049

SMART Domains

Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	1.01e-27	SMART
low complexity region	249	262	N/A	INTRINSIC
low complexity region	367	384	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139869

SMART Domains

Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	1.01e-27	SMART
low complexity region	218	231	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
SH3	389	444	5.1e-23	SMART
low complexity region	445	460	N/A	INTRINSIC
SH3	464	521	3.9e-19	SMART
SH3	567	623	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140088

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153798

SMART Domains

Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	9.63e-34	SMART
low complexity region	233	246	N/A	INTRINSIC
low complexity region	351	368	N/A	INTRINSIC
SH3	403	458	5.1e-23	SMART
low complexity region	459	474	N/A	INTRINSIC
SH3	478	535	3.9e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155858

SMART Domains

Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	50	63	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
low complexity region	138	156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171337

SMART Domains

Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	754	765	N/A	INTRINSIC
SH3	980	1035	5.1e-23	SMART
low complexity region	1036	1051	N/A	INTRINSIC
SH3	1055	1112	3.9e-19	SMART
SH3	1158	1214	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211095

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211721

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.0%
20x: 84.7%

Validation Efficiency

95% (94/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	T	G	12: 72,881,421	N512T	possibly damaging	Het
Aadacl2	A	T	3: 60,024,892	H276L	probably damaging	Het
Adam12	G	A	7: 133,931,814	T445M	probably benign	Het
Ash2l	A	T	8: 25,827,378	F290L	probably benign	Het
Asxl3	C	T	18: 22,525,224	P2097L	probably benign	Het
Atmin	A	G	8: 116,957,376	I592V	probably damaging	Het
Atxn2	T	C	5: 121,803,082		probably null	Het
BC004004	T	C	17: 29,296,691		probably null	Het
Cacna1e	T	C	1: 154,561,806	N328S	possibly damaging	Het
Cacna2d1	A	T	5: 16,355,495	K765I	probably damaging	Het
Cc2d1a	A	G	8: 84,133,975		probably null	Het
Ccdc28b	A	G	4: 129,620,615	V198A	probably benign	Het
Ces1b	G	T	8: 93,068,108	R288S	probably damaging	Het
Cfap100	T	G	6: 90,412,184	T198P	probably benign	Het
Clint1	T	C	11: 45,890,783	S227P	probably damaging	Het
Cntn5	C	A	9: 10,145,339	C122F	probably damaging	Het
Col3a1	A	G	1: 45,343,312		probably null	Het
Cyp4a10	A	C	4: 115,529,449	D431A	probably damaging	Het
Cyp4f16	CTATG	CTATGTATG	17: 32,550,734		probably null	Het
Dlc1	A	T	8: 36,593,463		probably benign	Het
Dlgap2	T	C	8: 14,727,060	S102P	probably benign	Het
Dnah7b	G	A	1: 46,078,593		probably benign	Het
Dock10	A	C	1: 80,549,136	S1124A	probably benign	Het
Dscam	C	T	16: 96,819,951	R519H	probably damaging	Het
Efcab3	A	T	11: 105,108,755		probably benign	Het
Evi2a	G	T	11: 79,527,270	N171K	probably damaging	Het
Fbxl15	T	C	19: 46,330,245	L286P	probably damaging	Het
Fpr1	T	A	17: 17,877,263	I155F	probably benign	Het
Gcat	C	T	15: 79,033,994	A84V	probably null	Het
Gls	A	G	1: 52,191,134	F473L	possibly damaging	Het
Gnat1	T	C	9: 107,676,965	D169G	probably damaging	Het
Grm3	A	C	5: 9,589,958	M29R	probably benign	Het
Herc1	A	T	9: 66,467,803	D3303V	probably damaging	Het
Ibsp	G	A	5: 104,310,539	G314D	unknown	Het
Lgr6	C	A	1: 134,987,472	A513S	probably damaging	Het
Lrmp	C	T	6: 145,174,511	T484M	possibly damaging	Het
Lrriq4	T	A	3: 30,650,761	C313S	probably damaging	Het
March10	G	T	11: 105,390,583	T292K	probably damaging	Het
Mcoln2	C	A	3: 146,190,382	Y6*	probably null	Het
Mup4	A	G	4: 59,958,076	I164T	probably damaging	Het
Myo1b	T	C	1: 51,778,558		probably benign	Het
Ncam1	A	G	9: 49,544,800	I506T	probably damaging	Het
Notch1	A	T	2: 26,480,964		probably benign	Het
Nr4a3	A	T	4: 48,051,777	Q177L	probably benign	Het
Nsun4	A	G	4: 116,052,950	S138P	possibly damaging	Het
Olfr11	G	T	13: 21,639,390	N44K	probably benign	Het
Olfr403	A	G	11: 74,195,679	M59V	probably damaging	Het
Olfr716	A	T	7: 107,148,198	N294I	probably damaging	Het
Olfr729	T	C	14: 50,148,358	N172S	probably damaging	Het
Pagr1a	A	T	7: 127,016,297		probably benign	Het
Pcdhb2	A	T	18: 37,296,290	I82L	probably benign	Het
Pds5b	A	T	5: 150,754,417	N500I	probably damaging	Het
Pik3r6	A	T	11: 68,531,445	E223D	possibly damaging	Het
Pkhd1l1	A	T	15: 44,540,988		probably benign	Het
Prex1	T	C	2: 166,580,463	D1204G	probably damaging	Het
Prickle1	C	T	15: 93,505,074	E244K	possibly damaging	Het
Ptprd	A	T	4: 76,084,552	V211E	probably damaging	Het
Rad51d	G	A	11: 82,890,353	R23*	probably null	Het
Rapgef6	G	A	11: 54,626,708	G262R	probably damaging	Het
Reln	A	G	5: 22,128,602		probably benign	Het
Rev1	T	C	1: 38,088,205	T325A	probably damaging	Het
Rnd3	T	A	2: 51,132,506	I175L	probably benign	Het
Rp1	C	A	1: 4,347,396	L1164F	probably damaging	Het
S100a7a	T	C	3: 90,655,635	V43A	probably benign	Het
Scaper	A	C	9: 55,602,918	Y1104*	probably null	Het
Scn2a	T	A	2: 65,764,594	V1929D	probably benign	Het
Scn3a	T	C	2: 65,529,441	N141S	possibly damaging	Het
Slc12a7	T	G	13: 73,801,008	L718R	probably damaging	Het
Slc15a2	T	C	16: 36,784,643		probably benign	Het
Slc35b3	G	A	13: 38,954,134	Q100*	probably null	Het
Slc9a5	T	A	8: 105,355,153	V170E	possibly damaging	Het
Snx5	T	G	2: 144,254,811	K278T	possibly damaging	Het
Stab1	C	T	14: 31,151,690	W1008*	probably null	Het
Stab2	C	T	10: 86,861,367		probably null	Het
Tacc3	A	G	5: 33,667,977	E377G	probably benign	Het
Tango6	T	C	8: 106,689,039	L164P	probably damaging	Het
Tbc1d12	T	A	19: 38,914,352	S570T	possibly damaging	Het
Thbs1	T	C	2: 118,114,355	F217L	probably damaging	Het
Tmbim6	T	A	15: 99,402,123	V40E	probably damaging	Het
Tmigd1	A	T	11: 76,910,160	N158Y	probably damaging	Het
Top3b	C	T	16: 16,892,777	R824*	probably null	Het
Tram1l1	A	T	3: 124,321,931	K247*	probably null	Het
Tsc2	T	C	17: 24,614,392	Y686C	probably damaging	Het
Tsga10	T	C	1: 37,819,599	Q218R	probably damaging	Het
Uba6	G	T	5: 86,140,423	A439D	probably damaging	Het
Ubn1	C	A	16: 5,077,294	P735T	probably damaging	Het
Usp40	A	G	1: 87,982,086	S549P	probably benign	Het
Utp20	T	C	10: 88,819,339	T176A	probably benign	Het
Utp4	T	G	8: 106,898,053		probably benign	Het
Xpo5	C	T	17: 46,207,927		probably benign	Het
Zfp979	A	T	4: 147,614,036	I72K	possibly damaging	Het

Other mutations in Sorbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Sorbs2	APN	8	45799706	splice site	probably null
IGL00964:Sorbs2	APN	8	45795677	missense	probably damaging	0.97
IGL01101:Sorbs2	APN	8	45745423	missense	possibly damaging	0.93
IGL01586:Sorbs2	APN	8	45795594	missense	probably damaging	1.00
IGL01611:Sorbs2	APN	8	45795344	missense	probably null
IGL01662:Sorbs2	APN	8	45803829	splice site	probably benign
IGL01970:Sorbs2	APN	8	45745803	missense	probably damaging	1.00
IGL02169:Sorbs2	APN	8	45823749	missense	probably damaging	0.98
IGL02685:Sorbs2	APN	8	45803840	missense	probably benign	0.00
IGL03036:Sorbs2	APN	8	45782865	missense	probably benign
IGL03151:Sorbs2	APN	8	45799713	missense	probably benign	0.01
IGL03164:Sorbs2	APN	8	45782874	missense	probably benign	0.01
IGL03350:Sorbs2	APN	8	45805807	missense	probably damaging	0.99
BB001:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
BB011:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R0058:Sorbs2	UTSW	8	45785254	splice site	probably null
R0058:Sorbs2	UTSW	8	45796263	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0265:Sorbs2	UTSW	8	45785337	splice site	probably benign
R0306:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R0308:Sorbs2	UTSW	8	45795130	nonsense	probably null
R0638:Sorbs2	UTSW	8	45796310	missense	probably damaging	1.00
R0940:Sorbs2	UTSW	8	45796502	missense	probably benign	0.39
R1110:Sorbs2	UTSW	8	45795730	missense	probably benign	0.13
R1160:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1226:Sorbs2	UTSW	8	45795619	missense	probably damaging	1.00
R1271:Sorbs2	UTSW	8	45795967	missense	probably damaging	1.00
R1514:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R1557:Sorbs2	UTSW	8	45759197	splice site	probably benign
R1582:Sorbs2	UTSW	8	45805777	missense	probably damaging	0.99
R1626:Sorbs2	UTSW	8	45769854	missense	probably damaging	1.00
R1700:Sorbs2	UTSW	8	45800984	missense	probably damaging	1.00
R1759:Sorbs2	UTSW	8	45763019	makesense	probably null
R1766:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1782:Sorbs2	UTSW	8	45805696	missense	probably damaging	1.00
R1932:Sorbs2	UTSW	8	45796352	missense	probably benign	0.01
R1954:Sorbs2	UTSW	8	45745738	missense	probably benign	0.23
R2060:Sorbs2	UTSW	8	45775629	missense	probably damaging	1.00
R2149:Sorbs2	UTSW	8	45795443	missense	probably damaging	0.99
R2568:Sorbs2	UTSW	8	45795370	nonsense	probably null
R3812:Sorbs2	UTSW	8	45763030	missense	probably benign	0.00
R3831:Sorbs2	UTSW	8	45795095	missense	probably damaging	1.00
R3975:Sorbs2	UTSW	8	45772710	critical splice donor site	probably null
R4033:Sorbs2	UTSW	8	45775595	missense	probably damaging	1.00
R4714:Sorbs2	UTSW	8	45795293	missense	possibly damaging	0.89
R4828:Sorbs2	UTSW	8	45741615	intron	probably benign
R4926:Sorbs2	UTSW	8	45796217	missense	probably benign	0.03
R5027:Sorbs2	UTSW	8	45746534	splice site	probably null
R5118:Sorbs2	UTSW	8	45795785	missense	probably damaging	1.00
R5159:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R5342:Sorbs2	UTSW	8	45796013	missense	probably damaging	0.96
R5390:Sorbs2	UTSW	8	45819741	missense	probably damaging	1.00
R5436:Sorbs2	UTSW	8	45796001	missense	probably damaging	1.00
R5655:Sorbs2	UTSW	8	45741581	critical splice donor site	probably null
R5687:Sorbs2	UTSW	8	45775632	missense	probably damaging	1.00
R5695:Sorbs2	UTSW	8	45792875	missense	probably benign	0.27
R5733:Sorbs2	UTSW	8	45759189	missense	probably damaging	1.00
R5928:Sorbs2	UTSW	8	45763183	missense	probably damaging	1.00
R5949:Sorbs2	UTSW	8	45769897	critical splice donor site	probably null
R6341:Sorbs2	UTSW	8	45770578	missense	probably damaging	1.00
R6620:Sorbs2	UTSW	8	45796176	missense	probably damaging	1.00
R6761:Sorbs2	UTSW	8	45772614	missense	probably damaging	1.00
R7349:Sorbs2	UTSW	8	45795823	nonsense	probably null
R7404:Sorbs2	UTSW	8	45759196	splice site	probably null
R7524:Sorbs2	UTSW	8	45795656	missense	probably benign	0.00
R7809:Sorbs2	UTSW	8	45745428	missense	possibly damaging	0.93
R7820:Sorbs2	UTSW	8	45796556	missense	probably null	0.16
R7924:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R8285:Sorbs2	UTSW	8	45796067	missense	probably damaging	0.98
R8696:Sorbs2	UTSW	8	45795649	missense	possibly damaging	0.95
R8927:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R8928:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R9005:Sorbs2	UTSW	8	45795737	missense	probably benign
R9006:Sorbs2	UTSW	8	45805821	missense	possibly damaging	0.95
R9016:Sorbs2	UTSW	8	45795737	missense	probably benign
R9017:Sorbs2	UTSW	8	45795737	missense	probably benign
R9091:Sorbs2	UTSW	8	45795737	missense	probably benign
R9196:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9256:Sorbs2	UTSW	8	45795737	missense	probably benign
R9282:Sorbs2	UTSW	8	45795737	missense	probably benign
R9283:Sorbs2	UTSW	8	45795737	missense	probably benign
R9384:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9624:Sorbs2	UTSW	8	45775653	missense	possibly damaging	0.89
R9664:Sorbs2	UTSW	8	45823751	missense	probably benign	0.05
Z1176:Sorbs2	UTSW	8	45790025	missense	probably null	0.96
Z1177:Sorbs2	UTSW	8	45782959	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAGCTGAAGGCACCTTTGCCC -3'
(R):5'- TGATTGAATACACACCATGAGGCTTGG -3'

Sequencing Primer
(F):5'- TGCtgttttgttttttgtttgttttg -3'
(R):5'- GGCTTGGTACTTAAAATAAGAATGCG -3'

Posted On

2014-03-14