Incidental Mutation 'R1542:Serpinb3c'
ID 171778
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms ovalbumin, Serpinb4, 1110013A16Rik, 1110001H02Rik, Scca2
MMRRC Submission 039581-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R1542 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 107198931-107206101 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107200517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 209 (M209V)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
AlphaFold A2RSF9
Predicted Effect probably damaging
Transcript: ENSMUST00000027565
AA Change: M209V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: M209V

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,208,055 (GRCm39) M208T possibly damaging Het
Acsbg2 T A 17: 57,156,791 (GRCm39) I416F probably damaging Het
Adam6b G A 12: 113,454,559 (GRCm39) D459N possibly damaging Het
Adprh A T 16: 38,266,286 (GRCm39) D285E probably damaging Het
Aggf1 A T 13: 95,507,450 (GRCm39) C112S probably benign Het
Als2cl T C 9: 110,723,102 (GRCm39) V602A probably benign Het
Angptl2 G T 2: 33,118,897 (GRCm39) V224F probably benign Het
Ap3b2 A T 7: 81,127,825 (GRCm39) probably null Het
Aqp2 A C 15: 99,481,723 (GRCm39) I206L probably benign Het
Asap2 A G 12: 21,315,998 (GRCm39) D930G probably damaging Het
Cacna1e T A 1: 154,353,525 (GRCm39) M682L probably benign Het
Ccdc18 A G 5: 108,360,054 (GRCm39) N1146S probably benign Het
Ccr4 G A 9: 114,321,073 (GRCm39) H331Y probably benign Het
Cd33 A G 7: 43,181,530 (GRCm39) L210P probably damaging Het
Cep85l T C 10: 53,177,680 (GRCm39) E351G probably damaging Het
Cntn6 C A 6: 104,825,061 (GRCm39) T867K probably damaging Het
Cpeb2 C T 5: 43,443,218 (GRCm39) R970C probably damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dscaml1 T A 9: 45,660,738 (GRCm39) I1693K possibly damaging Het
Ebf4 A T 2: 130,207,418 (GRCm39) M621L probably benign Het
Elp4 G T 2: 105,624,954 (GRCm39) T313N probably benign Het
Epas1 T A 17: 87,131,918 (GRCm39) I373N possibly damaging Het
Etnk1 A T 6: 143,126,367 (GRCm39) M71L probably benign Het
Fry C T 5: 150,328,431 (GRCm39) T1257I probably benign Het
Gm21834 A G 17: 58,048,946 (GRCm39) F90S possibly damaging Het
Gm8674 T A 13: 50,054,039 (GRCm39) noncoding transcript Het
Gna11 T C 10: 81,369,162 (GRCm39) T134A probably benign Het
Golga5 C T 12: 102,440,979 (GRCm39) S238F probably damaging Het
Grin2a T A 16: 9,397,067 (GRCm39) N1007Y probably damaging Het
H3c6 A G 13: 23,746,338 (GRCm39) F68L probably damaging Het
Ifnar2 G A 16: 91,196,153 (GRCm39) V253M possibly damaging Het
Insl5 A T 4: 102,875,382 (GRCm39) S123T probably damaging Het
Itgb2 T C 10: 77,395,320 (GRCm39) S474P probably benign Het
Kcnb2 A G 1: 15,781,012 (GRCm39) H628R probably benign Het
L3mbtl2 G A 15: 81,566,352 (GRCm39) D392N probably null Het
Lrp1b G T 2: 41,013,724 (GRCm39) T1813K probably damaging Het
Map3k4 A G 17: 12,454,793 (GRCm39) L1399P probably damaging Het
Mbtps1 A C 8: 120,272,986 (GRCm39) probably null Het
Mettl25 A T 10: 105,661,981 (GRCm39) S330T probably benign Het
Mical2 T C 7: 111,908,675 (GRCm39) L211P probably damaging Het
Mmrn1 T A 6: 60,922,102 (GRCm39) S186R probably damaging Het
Mob3b C A 4: 35,084,046 (GRCm39) V48L possibly damaging Het
Napsa A T 7: 44,231,113 (GRCm39) H114L probably damaging Het
Nsmce4a A T 7: 130,147,623 (GRCm39) probably null Het
Nup62 A G 7: 44,479,353 (GRCm39) K456R possibly damaging Het
Nwd2 T A 5: 63,964,318 (GRCm39) W1301R probably damaging Het
Oprm1 G T 10: 6,738,960 (GRCm39) W29L probably damaging Het
Or10al2 A T 17: 37,983,142 (GRCm39) E76V probably damaging Het
Or1l4b T A 2: 37,036,978 (GRCm39) S251R probably damaging Het
Or2c1 T A 16: 3,657,696 (GRCm39) N286K probably damaging Het
Or5w17 A G 2: 87,583,662 (GRCm39) V225A probably damaging Het
Pals2 A G 6: 50,175,306 (GRCm39) Y539C probably damaging Het
Pcnt T G 10: 76,225,221 (GRCm39) N1761T probably benign Het
Pcnt C T 10: 76,237,220 (GRCm39) M1355I probably benign Het
Pde11a A T 2: 75,877,199 (GRCm39) S757T probably benign Het
Pde6a T A 18: 61,390,116 (GRCm39) I490N possibly damaging Het
Pgap1 A G 1: 54,531,249 (GRCm39) V742A probably benign Het
Pik3c2b T C 1: 133,017,772 (GRCm39) L915P probably damaging Het
Pkd1l1 A G 11: 8,824,179 (GRCm39) C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,391,587 (GRCm39) H1551L probably benign Het
Plxnb2 C T 15: 89,050,124 (GRCm39) C491Y probably damaging Het
Ppt1 C A 4: 122,751,402 (GRCm39) H300N probably benign Het
Prpf3 T A 3: 95,743,782 (GRCm39) Q457L probably benign Het
Ranbp17 C T 11: 33,214,672 (GRCm39) V914I probably benign Het
Rasal2 T C 1: 157,003,421 (GRCm39) I413V possibly damaging Het
Rb1cc1 G A 1: 6,314,473 (GRCm39) V382I possibly damaging Het
Rere T A 4: 150,700,399 (GRCm39) F1125I probably damaging Het
Rprd2 A T 3: 95,672,988 (GRCm39) V805E possibly damaging Het
Septin10 T G 10: 59,002,428 (GRCm39) E162A probably damaging Het
Septin12 G T 16: 4,810,159 (GRCm39) D125E probably benign Het
Serpina6 A G 12: 103,620,732 (GRCm39) Y6H probably benign Het
Slc2a7 A T 4: 150,252,928 (GRCm39) T523S probably damaging Het
Smdt1 T C 15: 82,230,376 (GRCm39) V31A possibly damaging Het
Snrnp48 T C 13: 38,404,680 (GRCm39) I245T probably damaging Het
Spink2 G A 5: 77,354,812 (GRCm39) T33I probably damaging Het
Sptan1 A G 2: 29,917,139 (GRCm39) T2204A probably damaging Het
Synj2 A G 17: 6,075,292 (GRCm39) D306G probably benign Het
Tas2r109 A G 6: 132,957,873 (GRCm39) I19T possibly damaging Het
Tbk1 C T 10: 121,395,840 (GRCm39) V418M probably benign Het
Tcerg1 A G 18: 42,686,495 (GRCm39) E684G probably damaging Het
Tenm2 T C 11: 36,191,047 (GRCm39) N308S probably damaging Het
Tfb2m A T 1: 179,365,426 (GRCm39) probably null Het
Tmc1 T A 19: 20,793,486 (GRCm39) L558F probably damaging Het
Tmprss5 T A 9: 49,020,434 (GRCm39) I80N possibly damaging Het
Trappc2l G A 8: 123,342,146 (GRCm39) V131M probably damaging Het
Trpm7 A C 2: 126,664,519 (GRCm39) Y953* probably null Het
Ttn T C 2: 76,583,859 (GRCm39) R22383G probably damaging Het
Ugt1a6b G A 1: 88,034,983 (GRCm39) G107D probably benign Het
Vmn1r197 A T 13: 22,512,520 (GRCm39) Y147F probably benign Het
Zfp507 A T 7: 35,494,226 (GRCm39) N272K possibly damaging Het
Zfp526 G A 7: 24,925,687 (GRCm39) E649K probably benign Het
Zswim6 G A 13: 107,863,769 (GRCm39) noncoding transcript Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107,203,990 (GRCm39) critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107,200,513 (GRCm39) missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107,200,914 (GRCm39) missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107,199,702 (GRCm39) missense probably benign
IGL02184:Serpinb3c APN 1 107,199,648 (GRCm39) missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107,200,872 (GRCm39) nonsense probably null
IGL03131:Serpinb3c APN 1 107,199,457 (GRCm39) missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107,199,603 (GRCm39) missense probably benign 0.00
BB001:Serpinb3c UTSW 1 107,200,904 (GRCm39) missense probably damaging 1.00
BB011:Serpinb3c UTSW 1 107,200,904 (GRCm39) missense probably damaging 1.00
R0207:Serpinb3c UTSW 1 107,204,722 (GRCm39) missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107,204,651 (GRCm39) missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107,199,432 (GRCm39) missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107,199,504 (GRCm39) missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107,199,574 (GRCm39) missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107,204,661 (GRCm39) nonsense probably null
R5464:Serpinb3c UTSW 1 107,199,434 (GRCm39) missense probably damaging 0.99
R5636:Serpinb3c UTSW 1 107,202,744 (GRCm39) missense possibly damaging 0.57
R5677:Serpinb3c UTSW 1 107,199,533 (GRCm39) missense probably damaging 1.00
R5965:Serpinb3c UTSW 1 107,204,653 (GRCm39) missense probably benign 0.01
R6424:Serpinb3c UTSW 1 107,199,359 (GRCm39) makesense probably null
R7132:Serpinb3c UTSW 1 107,204,681 (GRCm39) missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107,200,892 (GRCm39) missense probably null 1.00
R7319:Serpinb3c UTSW 1 107,200,817 (GRCm39) missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107,199,444 (GRCm39) missense probably damaging 1.00
R7871:Serpinb3c UTSW 1 107,200,883 (GRCm39) missense possibly damaging 0.95
R7922:Serpinb3c UTSW 1 107,199,744 (GRCm39) missense probably damaging 1.00
R7924:Serpinb3c UTSW 1 107,200,904 (GRCm39) missense probably damaging 1.00
R8114:Serpinb3c UTSW 1 107,204,034 (GRCm39) missense probably benign 0.03
R8189:Serpinb3c UTSW 1 107,204,039 (GRCm39) missense probably benign 0.00
R8384:Serpinb3c UTSW 1 107,199,697 (GRCm39) missense probably benign 0.02
R9042:Serpinb3c UTSW 1 107,199,731 (GRCm39) missense probably damaging 1.00
R9518:Serpinb3c UTSW 1 107,200,468 (GRCm39) missense probably damaging 0.99
R9566:Serpinb3c UTSW 1 107,200,425 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACACAAGCCTTACCTGCTTCAG -3'
(R):5'- TCCTCCAGGAAAGCTCCTTGTACTG -3'

Sequencing Primer
(F):5'- GACCATCGATTTCCATTGGCAG -3'
(R):5'- GCTCCTTGTACTGATGATAGACAC -3'
Posted On 2014-04-13