Incidental Mutation 'R1542:Pde11a'
ID171787
Institutional Source Beutler Lab
Gene Symbol Pde11a
Ensembl Gene ENSMUSG00000075270
Gene Namephosphodiesterase 11A
SynonymsA630086N24Rik, 6330414F14Rik
MMRRC Submission 039581-MU
Accession Numbers

Genbank: NM_001081033; MGI: 3036251

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1542 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location75989141-76338774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76046855 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 757 (S757T)
Ref Sequence ENSEMBL: ENSMUSP00000097572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099992]
Predicted Effect probably benign
Transcript: ENSMUST00000099992
AA Change: S757T

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097572
Gene: ENSMUSG00000075270
AA Change: S757T

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 149 164 N/A INTRINSIC
GAF 217 380 1.79e-30 SMART
GAF 402 568 2.34e-25 SMART
HDc 661 830 7.75e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000144892
AA Change: S364T
SMART Domains Protein: ENSMUSP00000115662
Gene: ENSMUSG00000075270
AA Change: S364T

DomainStartEndE-ValueType
GAF 41 207 9.16e-19 SMART
HDc 269 438 2.04e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have enlarged lateral ventricles and exhibit abnormal behavior. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,414,406 M208T possibly damaging Het
Acsbg2 T A 17: 56,849,791 I416F probably damaging Het
Adam6b G A 12: 113,490,939 D459N possibly damaging Het
Adprh A T 16: 38,445,924 D285E probably damaging Het
Aggf1 A T 13: 95,370,942 C112S probably benign Het
Als2cl T C 9: 110,894,034 V602A probably benign Het
Angptl2 G T 2: 33,228,885 V224F probably benign Het
Ap3b2 A T 7: 81,478,077 probably null Het
Aqp2 A C 15: 99,583,842 I206L probably benign Het
Asap2 A G 12: 21,265,997 D930G probably damaging Het
Cacna1e T A 1: 154,477,779 M682L probably benign Het
Ccdc18 A G 5: 108,212,188 N1146S probably benign Het
Ccr4 G A 9: 114,492,005 H331Y probably benign Het
Cd33 A G 7: 43,532,106 L210P probably damaging Het
Cep85l T C 10: 53,301,584 E351G probably damaging Het
Cntn6 C A 6: 104,848,100 T867K probably damaging Het
Cpeb2 C T 5: 43,285,875 R970C probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dscaml1 T A 9: 45,749,440 I1693K possibly damaging Het
Ebf4 A T 2: 130,365,498 M621L probably benign Het
Elp4 G T 2: 105,794,609 T313N probably benign Het
Epas1 T A 17: 86,824,490 I373N possibly damaging Het
Etnk1 A T 6: 143,180,641 M71L probably benign Het
Fry C T 5: 150,404,966 T1257I probably benign Het
Gm21834 A G 17: 57,741,951 F90S possibly damaging Het
Gm8674 T A 13: 49,900,003 noncoding transcript Het
Gna11 T C 10: 81,533,328 T134A probably benign Het
Golga5 C T 12: 102,474,720 S238F probably damaging Het
Grin2a T A 16: 9,579,203 N1007Y probably damaging Het
Hist1h3e A G 13: 23,562,164 F68L probably damaging Het
Ifnar2 G A 16: 91,399,265 V253M possibly damaging Het
Insl5 A T 4: 103,018,185 S123T probably damaging Het
Itgb2 T C 10: 77,559,486 S474P probably benign Het
Kcnb2 A G 1: 15,710,788 H628R probably benign Het
L3mbtl2 G A 15: 81,682,151 D392N probably null Het
Lrp1b G T 2: 41,123,712 T1813K probably damaging Het
Map3k4 A G 17: 12,235,906 L1399P probably damaging Het
Mbtps1 A C 8: 119,546,247 probably null Het
Mettl25 A T 10: 105,826,120 S330T probably benign Het
Mical2 T C 7: 112,309,468 L211P probably damaging Het
Mmrn1 T A 6: 60,945,118 S186R probably damaging Het
Mob3b C A 4: 35,084,046 V48L possibly damaging Het
Mpp6 A G 6: 50,198,326 Y539C probably damaging Het
Napsa A T 7: 44,581,689 H114L probably damaging Het
Nsmce4a A T 7: 130,545,893 probably null Het
Nup62 A G 7: 44,829,929 K456R possibly damaging Het
Nwd2 T A 5: 63,806,975 W1301R probably damaging Het
Olfr1141 A G 2: 87,753,318 V225A probably damaging Het
Olfr118 A T 17: 37,672,251 E76V probably damaging Het
Olfr15 T A 16: 3,839,832 N286K probably damaging Het
Olfr364-ps1 T A 2: 37,146,966 S251R probably damaging Het
Oprm1 G T 10: 6,788,960 W29L probably damaging Het
Pcnt T G 10: 76,389,387 N1761T probably benign Het
Pcnt C T 10: 76,401,386 M1355I probably benign Het
Pde6a T A 18: 61,257,045 I490N possibly damaging Het
Pgap1 A G 1: 54,492,090 V742A probably benign Het
Pik3c2b T C 1: 133,090,034 L915P probably damaging Het
Pkd1l1 A G 11: 8,874,179 C1129R possibly damaging Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Plxnb2 C T 15: 89,165,921 C491Y probably damaging Het
Ppt1 C A 4: 122,857,609 H300N probably benign Het
Prpf3 T A 3: 95,836,470 Q457L probably benign Het
Ranbp17 C T 11: 33,264,672 V914I probably benign Het
Rasal2 T C 1: 157,175,851 I413V possibly damaging Het
Rb1cc1 G A 1: 6,244,249 V382I possibly damaging Het
Rere T A 4: 150,615,942 F1125I probably damaging Het
Rprd2 A T 3: 95,765,676 V805E possibly damaging Het
Sept10 T G 10: 59,166,606 E162A probably damaging Het
Sept12 G T 16: 4,992,295 D125E probably benign Het
Serpina6 A G 12: 103,654,473 Y6H probably benign Het
Serpinb3c T C 1: 107,272,787 M209V probably damaging Het
Slc2a7 A T 4: 150,168,471 T523S probably damaging Het
Smdt1 T C 15: 82,346,175 V31A possibly damaging Het
Snrnp48 T C 13: 38,220,704 I245T probably damaging Het
Spink2 G A 5: 77,206,965 T33I probably damaging Het
Sptan1 A G 2: 30,027,127 T2204A probably damaging Het
Synj2 A G 17: 6,025,017 D306G probably benign Het
Tas2r109 A G 6: 132,980,910 I19T possibly damaging Het
Tbk1 C T 10: 121,559,935 V418M probably benign Het
Tcerg1 A G 18: 42,553,430 E684G probably damaging Het
Tenm2 T C 11: 36,300,220 N308S probably damaging Het
Tfb2m A T 1: 179,537,861 probably null Het
Tmc1 T A 19: 20,816,122 L558F probably damaging Het
Tmprss5 T A 9: 49,109,134 I80N possibly damaging Het
Trappc2l G A 8: 122,615,407 V131M probably damaging Het
Trpm7 A C 2: 126,822,599 Y953* probably null Het
Ttn T C 2: 76,753,515 R22383G probably damaging Het
Ugt1a6b G A 1: 88,107,261 G107D probably benign Het
Vmn1r197 A T 13: 22,328,350 Y147F probably benign Het
Zfp507 A T 7: 35,794,801 N272K possibly damaging Het
Zfp526 G A 7: 25,226,262 E649K probably benign Het
Zswim6 G A 13: 107,727,234 noncoding transcript Het
Other mutations in Pde11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pde11a APN 2 76215385 missense probably damaging 1.00
IGL01528:Pde11a APN 2 76194956 splice site probably benign
IGL02117:Pde11a APN 2 75991262 missense probably damaging 1.00
IGL02428:Pde11a APN 2 76046845 missense possibly damaging 0.68
IGL02455:Pde11a APN 2 76158393 missense possibly damaging 0.58
IGL02731:Pde11a APN 2 75991239 missense probably benign 0.00
IGL03068:Pde11a APN 2 76017864 missense probably damaging 1.00
IGL03081:Pde11a APN 2 76075930 splice site probably benign
D4186:Pde11a UTSW 2 76291290 missense probably damaging 1.00
R0323:Pde11a UTSW 2 76046774 splice site probably null
R0433:Pde11a UTSW 2 76337706 missense possibly damaging 0.47
R1226:Pde11a UTSW 2 76158354 missense probably benign 0.10
R1941:Pde11a UTSW 2 76291250 missense probably benign 0.10
R2107:Pde11a UTSW 2 76337922 missense probably damaging 1.00
R2394:Pde11a UTSW 2 76059061 missense probably benign 0.00
R3689:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3690:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3945:Pde11a UTSW 2 76075931 splice site probably benign
R4073:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4074:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4588:Pde11a UTSW 2 76029303 missense probably damaging 1.00
R4602:Pde11a UTSW 2 76158333 missense probably benign 0.05
R4604:Pde11a UTSW 2 76337793 missense possibly damaging 0.89
R4609:Pde11a UTSW 2 76291241 missense possibly damaging 0.94
R4610:Pde11a UTSW 2 76158333 missense probably benign 0.05
R5017:Pde11a UTSW 2 76136367 missense probably benign 0.05
R5519:Pde11a UTSW 2 76075955 missense probably damaging 1.00
R5930:Pde11a UTSW 2 76139831 splice site probably null
R6000:Pde11a UTSW 2 76017860 missense probably damaging 0.98
R6018:Pde11a UTSW 2 76017850 missense probably benign 0.00
R6913:Pde11a UTSW 2 76337740 missense probably damaging 1.00
R7117:Pde11a UTSW 2 76076004 missense probably damaging 1.00
R7258:Pde11a UTSW 2 76139906 missense possibly damaging 0.91
R7267:Pde11a UTSW 2 76337845 missense probably damaging 1.00
R7409:Pde11a UTSW 2 76005984 missense
R7451:Pde11a UTSW 2 76022773 missense possibly damaging 0.89
R7452:Pde11a UTSW 2 76136414 missense probably damaging 1.00
R7598:Pde11a UTSW 2 76136423 missense probably damaging 1.00
R7671:Pde11a UTSW 2 76215353 missense possibly damaging 0.81
R7886:Pde11a UTSW 2 76291203 missense probably benign
R7969:Pde11a UTSW 2 76291203 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATGCCACTGTTAGCCACTAATCC -3'
(R):5'- AGCTCCTCTGTTTGCCAGGACATC -3'

Sequencing Primer
(F):5'- ACTGTTAGCCACTAATCCTTGGAG -3'
(R):5'- cccacacatccatccagac -3'
Posted On2014-04-13