Incidental Mutation 'R1642:Dicer1'
ID173628
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Namedicer 1, ribonuclease type III
SynonymsD12Ertd7e
MMRRC Submission 039678-MU
Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1642 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104687742-104751952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104713156 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 521 (C521S)
Ref Sequence ENSEMBL: ENSMUSP00000043676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987]
Predicted Effect probably damaging
Transcript: ENSMUST00000041987
AA Change: C521S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: C521S

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222528
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104696772 missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104706327 missense probably null 0.75
IGL01527:Dicer1 APN 12 104691610 nonsense probably null
IGL01597:Dicer1 APN 12 104705210 nonsense probably null
IGL01636:Dicer1 APN 12 104722241 missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104702787 nonsense probably null
IGL01765:Dicer1 APN 12 104706740 missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104704180 missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104702553 missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104697020 missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104697035 missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104714832 missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104705129 missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104714906 missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104713107 missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104712197 missense probably damaging 0.98
everest UTSW 12 104705128 missense probably damaging 1.00
PIT4480001:Dicer1 UTSW 12 104696544 missense probably benign
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0219:Dicer1 UTSW 12 104692125 critical splice donor site probably null
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0385:Dicer1 UTSW 12 104704174 missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104731064 missense probably benign 0.04
R0426:Dicer1 UTSW 12 104702542 missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104702630 missense probably benign
R0502:Dicer1 UTSW 12 104705060 missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104691658 missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104702841 missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104702491 missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104706301 missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104706864 missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104706885 missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104691607 missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104729142 missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104729243 missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104721969 critical splice donor site probably null
R1651:Dicer1 UTSW 12 104708805 missense probably damaging 1.00
R1658:Dicer1 UTSW 12 104700414 missense probably benign
R1815:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104702884 missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104713214 missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104722031 missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104702949 missense probably benign 0.17
R2202:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2203:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2243:Dicer1 UTSW 12 104730188 missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104729228 missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104705114 missense probably damaging 1.00
R4482:Dicer1 UTSW 12 104706277 missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104704751 nonsense probably null
R4776:Dicer1 UTSW 12 104692446 missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104696591 missense probably benign 0.44
R4904:Dicer1 UTSW 12 104713066 missense probably benign
R5202:Dicer1 UTSW 12 104694731 nonsense probably null
R5272:Dicer1 UTSW 12 104704240 missense probably damaging 1.00
R5363:Dicer1 UTSW 12 104703151 missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104705128 missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104696462 missense probably benign 0.00
R6479:Dicer1 UTSW 12 104696723 missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104731023 missense probably damaging 1.00
R7234:Dicer1 UTSW 12 104708849 missense probably damaging 1.00
R7401:Dicer1 UTSW 12 104712278 missense probably benign
R7407:Dicer1 UTSW 12 104722351 nonsense probably null
R7471:Dicer1 UTSW 12 104694710 missense probably damaging 1.00
R7768:Dicer1 UTSW 12 104706697 missense probably damaging 0.99
R7831:Dicer1 UTSW 12 104708800 missense probably damaging 1.00
R7914:Dicer1 UTSW 12 104708800 missense probably damaging 1.00
R7998:Dicer1 UTSW 12 104704069 missense probably damaging 1.00
R8010:Dicer1 UTSW 12 104692132 missense probably damaging 0.99
R8061:Dicer1 UTSW 12 104702818 nonsense probably null
X0018:Dicer1 UTSW 12 104696934 missense probably benign 0.00
Z1176:Dicer1 UTSW 12 104731020 missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- AGAACACTCTCAGCTCTCTGATCCG -3'
(R):5'- ACTCTGTCGCCAAATCAGTGCTC -3'

Sequencing Primer
(F):5'- GAAGGTGCATTATCTTTCTGATCTC -3'
(R):5'- GGCATGTGACTATGCCCTC -3'
Posted On2014-04-24