Incidental Mutation 'R1589:Tmc2'
ID 177693
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Name transmembrane channel-like gene family 2
MMRRC Submission 039626-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock # R1589 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130195194-130264445 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 130247960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 622 (I622F)
Ref Sequence ENSEMBL: ENSMUSP00000125843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
AlphaFold Q8R4P4
Predicted Effect probably damaging
Transcript: ENSMUST00000077988
AA Change: I622F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: I622F

transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166774
AA Change: I622F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: I622F

transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Meta Mutation Damage Score 0.1315 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cntnap5a T C 1: 116,060,200 F154L possibly damaging Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Fbxw11 C T 11: 32,733,612 T301M probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mmachc T A 4: 116,703,524 Q258L probably benign Het
Mpdz T A 4: 81,421,176 I5L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Scn11a A G 9: 119,769,807 V1219A probably damaging Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Trappc8 A G 18: 20,863,551 Y436H probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Wdr17 C T 8: 54,703,907 probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130261304 missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130264012 missense probably benign 0.02
IGL01094:Tmc2 APN 2 130260166 splice site probably benign
IGL01331:Tmc2 APN 2 130232356 missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130260224 nonsense probably null
IGL01926:Tmc2 APN 2 130260240 missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130240153 missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130229206 missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130240130 missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130229187 missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130240196 missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130226262 missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130248651 missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130202103 missense probably benign 0.00
R1183:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130248730 missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130248762 missense probably damaging 1.00
R1656:Tmc2 UTSW 2 130247934 missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130256116 missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130260225 missense probably benign 0.34
R1776:Tmc2 UTSW 2 130234869 missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130248756 missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130214664 splice site probably benign
R2020:Tmc2 UTSW 2 130232385 missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130214563 splice site probably null
R3968:Tmc2 UTSW 2 130202071 missense probably benign 0.02
R4732:Tmc2 UTSW 2 130261397 splice site probably null
R4733:Tmc2 UTSW 2 130261397 splice site probably null
R4989:Tmc2 UTSW 2 130202041 missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130234818 missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130240115 missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130241644 missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130232386 missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130264203 missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130261380 missense probably benign
R7132:Tmc2 UTSW 2 130232409 missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130234804 missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130196577 critical splice donor site probably null
R8167:Tmc2 UTSW 2 130241568 missense probably benign 0.04
R8554:Tmc2 UTSW 2 130264164 missense probably benign 0.00
R9134:Tmc2 UTSW 2 130232401 missense probably benign 0.21
R9169:Tmc2 UTSW 2 130241596 missense probably damaging 1.00
R9209:Tmc2 UTSW 2 130261397 splice site probably null
R9232:Tmc2 UTSW 2 130243129 missense probably damaging 1.00
X0019:Tmc2 UTSW 2 130208285 missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130201972 missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130208296 missense possibly damaging 0.56
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccttccttccctctcactttc -3'
Posted On 2014-04-24