Incidental Mutation 'R1775:Ank2'
ID204306
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Nameankyrin 2, brain
SynonymsAnkyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location126921612-127499350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126934547 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 799 (T799M)
Ref Sequence ENSEMBL: ENSMUSP00000043765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078]
Predicted Effect probably benign
Transcript: ENSMUST00000044443
AA Change: T799M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826
AA Change: T799M

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
ZU5 128 232 4.13e-61 SMART
Pfam:ZU5 289 374 2.8e-8 PFAM
low complexity region 587 597 N/A INTRINSIC
DEATH 603 697 1.52e-27 SMART
low complexity region 732 748 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182062
Predicted Effect unknown
Transcript: ENSMUST00000182064
AA Change: T3736M
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: T3736M

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182078
AA Change: T3649M
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: T3649M

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182271
Predicted Effect probably benign
Transcript: ENSMUST00000182571
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Serpinc1 A G 1: 160,989,647 N104D probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126959720 missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126933041 missense probably benign 0.00
IGL01969:Ank2 APN 3 126953223 missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126937874 splice site probably benign
IGL02537:Ank2 APN 3 126955916 missense probably damaging 1.00
IGL02858:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL02981:Ank2 APN 3 126934562 missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03024:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03074:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03111:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03129:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03174:Ank2 APN 3 126940095 missense probably damaging 0.98
IGL03177:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03185:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03188:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03242:Ank2 APN 3 126928805 missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03248:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03285:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03304:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03358:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03380:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03389:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03400:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03409:Ank2 APN 3 126955870 missense probably damaging 1.00
ballast UTSW 3 126943133 missense unknown
Chain UTSW 3 126946938 intron probably benign
drag UTSW 3 127003982 missense probably damaging 1.00
mooring UTSW 3 126934577 missense possibly damaging 0.73
Windlass UTSW 3 126946149 missense probably benign
R0033:Ank2 UTSW 3 127104748 splice site probably benign
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0079:Ank2 UTSW 3 126934615 missense probably benign 0.01
R0423:Ank2 UTSW 3 126929860 nonsense probably null
R0699:Ank2 UTSW 3 126929829 missense probably benign 0.00
R0724:Ank2 UTSW 3 126962337 missense probably damaging 1.00
R0990:Ank2 UTSW 3 126934666 missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126957302 missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126932982 missense probably benign
R1702:Ank2 UTSW 3 126955899 missense probably benign 0.00
R1703:Ank2 UTSW 3 126929766 missense probably damaging 1.00
R1710:Ank2 UTSW 3 126933060 nonsense probably null
R1743:Ank2 UTSW 3 126928675 missense probably damaging 0.99
R1852:Ank2 UTSW 3 126997851 critical splice donor site probably null
R2198:Ank2 UTSW 3 126934577 missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127248243 splice site probably null
R2893:Ank2 UTSW 3 127248243 splice site probably null
R2894:Ank2 UTSW 3 127248243 splice site probably null
R3148:Ank2 UTSW 3 126933075 missense probably benign 0.00
R3776:Ank2 UTSW 3 126942262 intron probably benign
R3784:Ank2 UTSW 3 126953193 missense probably damaging 1.00
R3856:Ank2 UTSW 3 126929844 missense probably benign 0.00
R3906:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3907:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3953:Ank2 UTSW 3 126988160 missense probably damaging 1.00
R3963:Ank2 UTSW 3 126934596 missense probably benign
R4367:Ank2 UTSW 3 126946149 missense probably benign
R4414:Ank2 UTSW 3 127225762 critical splice donor site probably null
R4432:Ank2 UTSW 3 126947806 intron probably benign
R4433:Ank2 UTSW 3 126947806 intron probably benign
R4579:Ank2 UTSW 3 126958963 missense probably damaging 1.00
R4597:Ank2 UTSW 3 126988151 missense probably damaging 1.00
R4603:Ank2 UTSW 3 127032016 missense probably benign 0.00
R4729:Ank2 UTSW 3 126976896 nonsense probably null
R4815:Ank2 UTSW 3 126936761 missense probably benign
R4826:Ank2 UTSW 3 126956001 missense probably benign 0.35
R4871:Ank2 UTSW 3 126959795 missense probably damaging 1.00
R4880:Ank2 UTSW 3 127046826 splice site probably null
R4915:Ank2 UTSW 3 126942671 intron probably benign
R4935:Ank2 UTSW 3 126956064 missense probably damaging 1.00
R4936:Ank2 UTSW 3 126955039 missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126962401 missense probably damaging 1.00
R4946:Ank2 UTSW 3 126941940 intron probably benign
R4963:Ank2 UTSW 3 127032096 missense probably benign 0.01
R4989:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126941871 intron probably benign
R5060:Ank2 UTSW 3 126945921 intron probably benign
R5078:Ank2 UTSW 3 126942353 intron probably benign
R5086:Ank2 UTSW 3 126947348 intron probably benign
R5134:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5148:Ank2 UTSW 3 127025636 intron probably null
R5175:Ank2 UTSW 3 127004024 missense probably damaging 1.00
R5275:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5295:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5303:Ank2 UTSW 3 126945804 intron probably benign
R5309:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5312:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5352:Ank2 UTSW 3 127498991 utr 5 prime probably benign
R5355:Ank2 UTSW 3 126944049 intron probably benign
R5386:Ank2 UTSW 3 126981933 missense probably benign 0.01
R5396:Ank2 UTSW 3 126953226 missense probably damaging 1.00
R5518:Ank2 UTSW 3 126959699 missense probably damaging 0.98
R5534:Ank2 UTSW 3 126947298 intron probably benign
R5554:Ank2 UTSW 3 126998973 missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126946305 intron probably benign
R5747:Ank2 UTSW 3 126941751 intron probably benign
R5794:Ank2 UTSW 3 126930020 missense probably benign 0.00
R5831:Ank2 UTSW 3 127339159 start gained probably benign
R5925:Ank2 UTSW 3 126932963 missense probably benign 0.18
R5954:Ank2 UTSW 3 126997861 missense probably benign 0.34
R5956:Ank2 UTSW 3 126942688 intron probably benign
R5986:Ank2 UTSW 3 127012686 missense possibly damaging 0.94
R5992:Ank2 UTSW 3 126959651 critical splice donor site probably null
R6020:Ank2 UTSW 3 126946821 intron probably benign
R6027:Ank2 UTSW 3 126997879 missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126943020 missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126955952 missense probably damaging 1.00
R6114:Ank2 UTSW 3 127011051 missense probably damaging 1.00
R6124:Ank2 UTSW 3 127248151 missense probably benign 0.31
R6156:Ank2 UTSW 3 126944237 missense probably damaging 1.00
R6173:Ank2 UTSW 3 127052746 missense probably damaging 1.00
R6176:Ank2 UTSW 3 126945471 missense probably benign 0.05
R6184:Ank2 UTSW 3 126962398 missense probably damaging 1.00
R6199:Ank2 UTSW 3 127004006 missense probably damaging 1.00
R6241:Ank2 UTSW 3 127052748 missense probably damaging 1.00
R6254:Ank2 UTSW 3 126941804 intron probably benign
R6259:Ank2 UTSW 3 127016986 missense probably benign 0.28
R6260:Ank2 UTSW 3 126943557 missense probably benign
R6321:Ank2 UTSW 3 126946938 intron probably benign
R6393:Ank2 UTSW 3 126929757 missense probably damaging 1.00
R6406:Ank2 UTSW 3 127032225 missense probably damaging 1.00
R6544:Ank2 UTSW 3 126933222 missense probably damaging 0.99
R6583:Ank2 UTSW 3 127016964 missense probably damaging 1.00
R6739:Ank2 UTSW 3 127079994 missense probably damaging 1.00
R6754:Ank2 UTSW 3 127096839 intron probably benign
R6786:Ank2 UTSW 3 126958932 missense probably damaging 0.99
R6798:Ank2 UTSW 3 126944264 intron probably benign
R6882:Ank2 UTSW 3 126945757 intron probably benign
R6940:Ank2 UTSW 3 126941972 intron probably benign
R6949:Ank2 UTSW 3 127010884 missense probably benign 0.00
R7001:Ank2 UTSW 3 127077581 missense probably damaging 1.00
R7033:Ank2 UTSW 3 126944850 nonsense probably null
R7036:Ank2 UTSW 3 126946392 intron probably benign
R7045:Ank2 UTSW 3 127012744 missense probably damaging 1.00
R7048:Ank2 UTSW 3 127025618 missense probably benign 0.03
R7054:Ank2 UTSW 3 126943303 intron probably benign
R7069:Ank2 UTSW 3 126946298 intron probably benign
R7091:Ank2 UTSW 3 127023351 missense probably damaging 0.98
R7107:Ank2 UTSW 3 127003982 missense probably damaging 1.00
R7175:Ank2 UTSW 3 126946941 missense unknown
R7191:Ank2 UTSW 3 126946392 missense unknown
R7272:Ank2 UTSW 3 126943133 missense unknown
R7381:Ank2 UTSW 3 126936628 missense possibly damaging 0.46
R7394:Ank2 UTSW 3 126936653 missense possibly damaging 0.77
R7462:Ank2 UTSW 3 126943034 missense unknown
R7490:Ank2 UTSW 3 126958889 missense probably damaging 0.99
R7514:Ank2 UTSW 3 127025603 missense probably benign 0.06
R7534:Ank2 UTSW 3 126934333 intron probably null
R7540:Ank2 UTSW 3 126988159 missense possibly damaging 0.94
R7547:Ank2 UTSW 3 126945203 missense unknown
R7579:Ank2 UTSW 3 126946398 missense unknown
R7584:Ank2 UTSW 3 126946128 nonsense probably null
R7625:Ank2 UTSW 3 127052800 missense probably damaging 1.00
R7698:Ank2 UTSW 3 127032211 missense probably benign 0.35
R7716:Ank2 UTSW 3 126943166 missense unknown
R7718:Ank2 UTSW 3 126965013 missense possibly damaging 0.88
R7722:Ank2 UTSW 3 127029302 missense probably benign 0.01
R7738:Ank2 UTSW 3 126947622 missense
RF020:Ank2 UTSW 3 126945476 missense unknown
Z1088:Ank2 UTSW 3 127029509 missense possibly damaging 0.45
Z1177:Ank2 UTSW 3 126944357
Predicted Primers PCR Primer
(F):5'- TGGCCTCACACAACACTGTC -3'
(R):5'- TCTGTGCTGCCAAGGAGAAG -3'

Sequencing Primer
(F):5'- ACACAACACTGTCACAATTATGTATC -3'
(R):5'- CTGCCAAGGAGAAGAAGGAGC -3'
Posted On2014-06-23