Incidental Mutation 'R1995:Gpbar1'
ID 225650
Institutional Source Beutler Lab
Gene Symbol Gpbar1
Ensembl Gene ENSMUSG00000064272
Gene Name G protein-coupled bile acid receptor 1
Synonyms BG37, GPR131, TGR5, M-BAR
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1995 (G1)
Quality Score 208
Status Not validated
Chromosome 1
Chromosomal Location 74278550-74279624 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74279444 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 282 (G282D)
Ref Sequence ENSEMBL: ENSMUSP00000077135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006462] [ENSMUST00000077985] [ENSMUST00000178235] [ENSMUST00000187046] [ENSMUST00000190008]
AlphaFold Q80SS6
Predicted Effect probably benign
Transcript: ENSMUST00000006462
SMART Domains Protein: ENSMUSP00000006462
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
low complexity region 46 64 N/A INTRINSIC
WD40 81 121 2.76e-2 SMART
WD40 124 163 4.83e-7 SMART
WD40 166 203 7.96e0 SMART
WD40 205 244 2.51e-5 SMART
WD40 247 289 2.38e-6 SMART
WD40 292 346 2.47e1 SMART
WD40 349 387 2.61e-3 SMART
WD40 390 429 1.75e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077985
AA Change: G282D

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077135
Gene: ENSMUSG00000064272
AA Change: G282D

DomainStartEndE-ValueType
Pfam:7tm_1 30 264 7.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178235
SMART Domains Protein: ENSMUSP00000136644
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
WD40 82 122 2.76e-2 SMART
WD40 125 164 4.83e-7 SMART
WD40 167 204 7.96e0 SMART
WD40 206 245 2.51e-5 SMART
WD40 248 290 2.38e-6 SMART
WD40 293 347 2.47e1 SMART
WD40 350 388 2.61e-3 SMART
WD40 391 430 1.75e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186833
Predicted Effect probably benign
Transcript: ENSMUST00000187046
SMART Domains Protein: ENSMUSP00000139411
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
WD40 20 60 1.7e-4 SMART
WD40 63 102 3e-9 SMART
WD40 120 160 1.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187908
Predicted Effect probably benign
Transcript: ENSMUST00000190008
SMART Domains Protein: ENSMUSP00000140427
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191258
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor (GPCR) superfamily. This enzyme functions as a cell surface receptor for bile acids. Treatment of cells expressing this GPCR with bile acids induces the production of intracellular cAMP, activation of a MAP kinase signaling pathway, and internalization of the receptor. The receptor is implicated in the suppression of macrophage functions and regulation of energy homeostasis by bile acids. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal cholesterol, bile, and insulin homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Gpbar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Gpbar1 UTSW 1 74278981 missense probably benign
R0502:Gpbar1 UTSW 1 74279392 missense probably benign 0.00
R0944:Gpbar1 UTSW 1 74279522 missense probably benign
R1993:Gpbar1 UTSW 1 74279444 missense possibly damaging 0.92
R2216:Gpbar1 UTSW 1 74278894 missense probably damaging 1.00
R2258:Gpbar1 UTSW 1 74279005 missense probably benign
R4871:Gpbar1 UTSW 1 74279543 missense probably damaging 0.96
R4973:Gpbar1 UTSW 1 74279545 unclassified probably benign
R4974:Gpbar1 UTSW 1 74279545 unclassified probably benign
R4975:Gpbar1 UTSW 1 74279545 unclassified probably benign
R4979:Gpbar1 UTSW 1 74279245 missense probably benign 0.01
R5728:Gpbar1 UTSW 1 74279057 missense probably damaging 1.00
R5730:Gpbar1 UTSW 1 74279036 missense probably damaging 1.00
R7180:Gpbar1 UTSW 1 74278633 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATGTACCCTCAACCCTGGCTAG -3'
(R):5'- TCCAAAGAAGTGGGGCACTG -3'

Sequencing Primer
(F):5'- TAGGGCTCTCACCTGGAGG -3'
(R):5'- CACTGTGAGATAGAAGAGTGTTCTG -3'
Posted On 2014-08-25