Incidental Mutation 'R1995:Kdm8'
ID225681
Institutional Source Beutler Lab
Gene Symbol Kdm8
Ensembl Gene ENSMUSG00000030752
Gene Namelysine (K)-specific demethylase 8
Synonyms
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1995 (G1)
Quality Score202
Status Not validated
Chromosome7
Chromosomal Location125444676-125462269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125452339 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 35 (G35S)
Ref Sequence ENSEMBL: ENSMUSP00000033010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033010] [ENSMUST00000135129]
Predicted Effect probably benign
Transcript: ENSMUST00000033010
AA Change: G35S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033010
Gene: ENSMUSG00000030752
AA Change: G35S

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
JmjC 269 414 2.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135129
SMART Domains Protein: ENSMUSP00000114890
Gene: ENSMUSG00000030752

DomainStartEndE-ValueType
Pfam:Cupin_8 13 152 1.4e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a histone lysine demethylase. Studies of a similar protein in mouse indicate a potential role for this protein as a tumor suppressor. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality during organogenesis associated with severe growth retardation and abnormal embryo turning. Observed phenotypes include open neural tubes and absent vitelline blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Kdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Kdm8 APN 7 125461205 missense probably damaging 1.00
IGL01975:Kdm8 APN 7 125452357 missense probably benign 0.04
IGL02019:Kdm8 APN 7 125452486 missense probably damaging 0.98
IGL03387:Kdm8 APN 7 125455106 missense probably benign 0.00
R0321:Kdm8 UTSW 7 125461006 missense probably damaging 1.00
R0479:Kdm8 UTSW 7 125452640 missense probably damaging 1.00
R4058:Kdm8 UTSW 7 125456494 missense probably damaging 1.00
R4760:Kdm8 UTSW 7 125455259 critical splice donor site probably null
R5683:Kdm8 UTSW 7 125455173 missense possibly damaging 0.93
R6876:Kdm8 UTSW 7 125452658 missense probably benign 0.00
R7189:Kdm8 UTSW 7 125460931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGACCTTGTTGAAACACACTG -3'
(R):5'- ACAGTAGTGGCCTTCTGTGG -3'

Sequencing Primer
(F):5'- CACTGGTGTGAAGTACAGGTG -3'
(R):5'- CTTCAGGAGGCAGCCGAAG -3'
Posted On2014-08-25