Incidental Mutation 'R2059:Vps13c'
ID228480
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission 040064-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2059 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67860833 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 111 (K111N)
Ref Sequence ENSEMBL: ENSMUSP00000150974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]
Predicted Effect probably damaging
Transcript: ENSMUST00000077879
AA Change: K111N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: K111N

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217386
AA Change: K111N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2048 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Adgrf3 G A 5: 30,199,491 H316Y possibly damaging Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ak5 T A 3: 152,660,637 L42F probably damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Als2cl T C 9: 110,885,438 V118A probably benign Het
Ano1 G C 7: 144,611,390 L641V probably damaging Het
Arfgef1 C T 1: 10,188,752 probably null Het
Atf6b A T 17: 34,648,575 probably null Het
Atf7ip T G 6: 136,609,348 probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Baz2a T A 10: 128,113,578 S347R probably damaging Het
C2cd3 T C 7: 100,455,493 probably benign Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Cdh12 T A 15: 21,583,740 N555K probably benign Het
Cenpj G A 14: 56,563,955 P187L possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cfap54 A T 10: 92,942,979 probably benign Het
Cgref1 T G 5: 30,933,645 D275A possibly damaging Het
Clgn A C 8: 83,399,978 N103H probably benign Het
Corin A G 5: 72,316,051 V905A possibly damaging Het
Csta1 A C 16: 36,122,322 D72E probably benign Het
Cul5 A T 9: 53,667,156 L44Q probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dync1i2 G A 2: 71,249,853 probably null Het
Enoph1 A G 5: 100,059,219 D55G probably damaging Het
Fam160b2 A G 14: 70,585,049 V744A possibly damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Foxi2 G T 7: 135,410,677 G98V probably damaging Het
Galr2 T C 11: 116,282,939 S132P probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gm15446 C T 5: 109,942,496 H205Y probably damaging Het
Gm21775 T A Y: 10,553,910 I153N probably benign Het
Grip1 A G 10: 120,038,698 K789R possibly damaging Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Herc2 T A 7: 56,163,897 H2625Q probably damaging Het
Hoxc9 A G 15: 102,984,123 D256G probably benign Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Irf2 A T 8: 46,807,345 N104I probably damaging Het
Kat6a A G 8: 22,939,305 N1559D possibly damaging Het
Kcnq4 G T 4: 120,698,002 F661L probably benign Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Khdrbs1 T C 4: 129,725,721 E209G probably damaging Het
Lama3 A T 18: 12,528,333 R2116S probably damaging Het
Mir124-2hg C A 3: 17,785,713 E65* probably null Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msl3l2 T A 10: 56,115,944 L255Q probably damaging Het
Mx1 T A 16: 97,454,179 K225* probably null Het
Nf1 T C 11: 79,556,723 V435A probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Nop2 T A 6: 125,139,860 M359K probably null Het
Nox1 T C X: 134,095,244 probably benign Het
Ogdhl G A 14: 32,332,884 R263K probably damaging Het
Olfr1388 T A 11: 49,444,451 V200E probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prl3a1 A G 13: 27,270,144 D35G probably benign Het
Ptprk T A 10: 28,566,603 I893N probably damaging Het
Ptprz1 T C 6: 22,986,323 probably benign Het
Rab3c A G 13: 110,260,516 V72A probably damaging Het
Rbms2 A G 10: 128,137,518 S251P probably benign Het
Rfwd3 A G 8: 111,297,495 V65A probably benign Het
Rps6kl1 T A 12: 85,139,623 Y211F probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Scg3 T C 9: 75,665,716 D311G probably damaging Het
Sdk2 C A 11: 113,854,332 M712I probably damaging Het
Serinc2 T G 4: 130,260,785 Y158S probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Shroom3 A T 5: 92,683,784 T40S probably damaging Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc7a3 A G X: 101,080,767 V464A probably benign Het
Snd1 T C 6: 28,745,207 F517S probably damaging Het
Spata13 A C 14: 60,759,591 I1165L possibly damaging Het
St8sia5 A T 18: 77,254,763 I390F probably damaging Het
Stat5b A T 11: 100,787,332 S652T probably benign Het
Stom A G 2: 35,316,025 S231P probably damaging Het
Sult1b1 A G 5: 87,535,033 Y18H probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem87a A T 2: 120,369,292 I457N probably damaging Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Ush2a T G 1: 188,381,549 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Ust A G 10: 8,207,566 Y349H probably damaging Het
V1rd19 A T 7: 24,003,834 M242L probably benign Het
Vmn1r33 T A 6: 66,612,202 M123L probably benign Het
Vwa3a A G 7: 120,758,949 D81G probably damaging Het
Zfp318 G A 17: 46,397,024 R336Q probably damaging Het
Zfp609 A G 9: 65,704,434 S416P possibly damaging Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTAGCAGCCAGTATTCTG -3'
(R):5'- CGATCCTCAATGTTGGCCAC -3'

Sequencing Primer
(F):5'- GCAGCCAGTATTCTGACATATTTTC -3'
(R):5'- CCTGATCTACAAAGTGAGTTCCAGG -3'
Posted On2014-09-17