Incidental Mutation 'R0008:Vps13c'
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
MMRRC Submission 038303-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0008 (G1)
Quality Score117
Status Validated
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67919262 bp
Amino Acid Change Valine to Alanine at position 1395 (V1395A)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
Predicted Effect probably benign
Transcript: ENSMUST00000077879
AA Change: V1395A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: V1395A

Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Arrdc3 T A 13: 80,883,892 Y81* probably null Het
Arrdc3 T A 13: 80,891,075 I75N probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Cp T A 3: 19,968,123 Y230N probably damaging Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Lrp6 T C 6: 134,485,753 E648G probably damaging Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prep T C 10: 45,115,078 V280A probably benign Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Rnf213 A C 11: 119,465,052 E4108A possibly damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Sh2d3c C G 2: 32,753,021 H587D probably damaging Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slc9b2 T A 3: 135,336,508 V516D possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 splice site probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 splice site probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
R7748:Vps13c UTSW 9 67963089 missense probably benign 0.03
R7779:Vps13c UTSW 9 67881422 missense probably damaging 1.00
R7788:Vps13c UTSW 9 67940483 missense probably benign 0.01
R7894:Vps13c UTSW 9 67926983 missense probably damaging 0.99
R8163:Vps13c UTSW 9 67950438 missense probably benign 0.08
R8165:Vps13c UTSW 9 67858790 missense probably benign 0.00
R8202:Vps13c UTSW 9 67944046 missense probably damaging 0.98
R8235:Vps13c UTSW 9 67927396 missense probably damaging 1.00
R8235:Vps13c UTSW 9 67955781 missense probably benign 0.01
R8253:Vps13c UTSW 9 67943488 nonsense probably null
R8261:Vps13c UTSW 9 67954980 missense probably damaging 1.00
R8348:Vps13c UTSW 9 67879103 missense possibly damaging 0.79
R8547:Vps13c UTSW 9 67945566 missense probably damaging 1.00
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttcacatgtctgtcgcttttac -3'
(R):5'- agagagaaagagagagagagagg -3'
Posted On2013-07-11