Mutagenetix > Incidental Mutations

Incidental Mutation 'R2059:Ptprk'

228486

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

040064-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2059 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28566603 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 893 (I893N)

Ref Sequence

ENSEMBL: ENSMUSP00000151866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

AlphaFold

P35822

Predicted Effect

probably damaging
Transcript: ENSMUST00000166468
AA Change: I879N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: I879N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218276
AA Change: I893N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218359
AA Change: I867N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000219621

Meta Mutation Damage Score

0.3188

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	G	A	6: 41,032,381	T173I	probably benign	Het
Adgrf3	G	A	5: 30,199,491	H316Y	possibly damaging	Het
Adgrf5	A	G	17: 43,428,586	Y72C	possibly damaging	Het
Ak5	T	A	3: 152,660,637	L42F	probably damaging	Het
Alas1	T	C	9: 106,241,290	E211G	probably damaging	Het
Alkbh1	C	T	12: 87,443,750		probably benign	Het
Als2cl	T	C	9: 110,885,438	V118A	probably benign	Het
Ano1	G	C	7: 144,611,390	L641V	probably damaging	Het
Arfgef1	C	T	1: 10,188,752		probably null	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Atf7ip	T	G	6: 136,609,348		probably benign	Het
Atp2b4	G	T	1: 133,726,537	Q777K	probably benign	Het
Baz2a	T	A	10: 128,113,578	S347R	probably damaging	Het
C2cd3	T	C	7: 100,455,493		probably benign	Het
Cage1	A	G	13: 38,023,380	V163A	probably benign	Het
Cdh12	T	A	15: 21,583,740	N555K	probably benign	Het
Cenpj	G	A	14: 56,563,955	P187L	possibly damaging	Het
Cep112	T	A	11: 108,519,261		probably null	Het
Cfap54	A	T	10: 92,942,979		probably benign	Het
Cgref1	T	G	5: 30,933,645	D275A	possibly damaging	Het
Clgn	A	C	8: 83,399,978	N103H	probably benign	Het
Corin	A	G	5: 72,316,051	V905A	possibly damaging	Het
Csta1	A	C	16: 36,122,322	D72E	probably benign	Het
Cul5	A	T	9: 53,667,156	L44Q	probably damaging	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Dync1i2	G	A	2: 71,249,853		probably null	Het
Enoph1	A	G	5: 100,059,219	D55G	probably damaging	Het
Fam160b2	A	G	14: 70,585,049	V744A	possibly damaging	Het
Fat4	T	A	3: 38,891,170	M1404K	possibly damaging	Het
Foxi2	G	T	7: 135,410,677	G98V	probably damaging	Het
Galr2	T	C	11: 116,282,939	S132P	probably damaging	Het
Gcm2	T	C	13: 41,109,954	M1V	probably null	Het
Gm15446	C	T	5: 109,942,496	H205Y	probably damaging	Het
Gm21775	T	A	Y: 10,553,910	I153N	probably benign	Het
Grip1	A	G	10: 120,038,698	K789R	possibly damaging	Het
Gsk3b	T	A	16: 38,187,909	D192E	probably benign	Het
Herc2	T	A	7: 56,163,897	H2625Q	probably damaging	Het
Hoxc9	A	G	15: 102,984,123	D256G	probably benign	Het
Il7	A	T	3: 7,573,915	N130K	probably damaging	Het
Irf2	A	T	8: 46,807,345	N104I	probably damaging	Het
Kat6a	A	G	8: 22,939,305	N1559D	possibly damaging	Het
Kcnq4	G	T	4: 120,698,002	F661L	probably benign	Het
Kdm5b	T	A	1: 134,613,214	D681E	probably benign	Het
Khdrbs1	T	C	4: 129,725,721	E209G	probably damaging	Het
Lama3	A	T	18: 12,528,333	R2116S	probably damaging	Het
Mir124-2hg	C	A	3: 17,785,713	E65*	probably null	Het
Mphosph10	T	A	7: 64,376,751	L650F	probably damaging	Het
Mrpl48	T	C	7: 100,549,333	E204G	probably damaging	Het
Msl3l2	T	A	10: 56,115,944	L255Q	probably damaging	Het
Mx1	T	A	16: 97,454,179	K225*	probably null	Het
Nf1	T	C	11: 79,556,723	V435A	probably damaging	Het
Nid1	A	C	13: 13,500,473	H926P	probably benign	Het
Nlrp9a	T	A	7: 26,557,362	I46K	possibly damaging	Het
Nop2	T	A	6: 125,139,860	M359K	probably null	Het
Nox1	T	C	X: 134,095,244		probably benign	Het
Ogdhl	G	A	14: 32,332,884	R263K	probably damaging	Het
Olfr1388	T	A	11: 49,444,451	V200E	probably damaging	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Pbsn	T	C	X: 77,847,976	K72E	probably damaging	Het
Pde12	T	C	14: 26,668,880	I225V	probably benign	Het
Ppt2	A	T	17: 34,622,844		probably benign	Het
Prl3a1	A	G	13: 27,270,144	D35G	probably benign	Het
Ptprz1	T	C	6: 22,986,323		probably benign	Het
Rab3c	A	G	13: 110,260,516	V72A	probably damaging	Het
Rbms2	A	G	10: 128,137,518	S251P	probably benign	Het
Rfwd3	A	G	8: 111,297,495	V65A	probably benign	Het
Rps6kl1	T	A	12: 85,139,623	Y211F	probably benign	Het
Saal1	T	C	7: 46,699,456	Q317R	probably damaging	Het
Scg3	T	C	9: 75,665,716	D311G	probably damaging	Het
Sdk2	C	A	11: 113,854,332	M712I	probably damaging	Het
Serinc2	T	G	4: 130,260,785	Y158S	probably damaging	Het
Serpinb9c	A	T	13: 33,156,871	C81*	probably null	Het
Sgpp2	T	A	1: 78,416,951	L197Q	probably damaging	Het
Shroom3	A	T	5: 92,683,784	T40S	probably damaging	Het
Sik1	A	G	17: 31,848,797	S435P	probably benign	Het
Slc7a3	A	G	X: 101,080,767	V464A	probably benign	Het
Snd1	T	C	6: 28,745,207	F517S	probably damaging	Het
Spata13	A	C	14: 60,759,591	I1165L	possibly damaging	Het
St8sia5	A	T	18: 77,254,763	I390F	probably damaging	Het
Stat5b	A	T	11: 100,787,332	S652T	probably benign	Het
Stom	A	G	2: 35,316,025	S231P	probably damaging	Het
Sult1b1	A	G	5: 87,535,033	Y18H	probably damaging	Het
Tgm4	T	C	9: 123,061,770	I54T	probably damaging	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tmem87a	A	T	2: 120,369,292	I457N	probably damaging	Het
Trim12c	A	G	7: 104,348,191	F53L	possibly damaging	Het
Ttc6	T	A	12: 57,737,693	D1849E	probably benign	Het
Ubap2l	A	T	3: 90,031,376		probably benign	Het
Ush2a	T	G	1: 188,381,549		probably null	Het
Usp17la	A	C	7: 104,861,171	T328P	probably damaging	Het
Ust	A	G	10: 8,207,566	Y349H	probably damaging	Het
V1rd19	A	T	7: 24,003,834	M242L	probably benign	Het
Vmn1r33	T	A	6: 66,612,202	M123L	probably benign	Het
Vps13c	A	T	9: 67,860,833	K111N	probably damaging	Het
Vwa3a	A	G	7: 120,758,949	D81G	probably damaging	Het
Zfp318	G	A	17: 46,397,024	R336Q	probably damaging	Het
Zfp609	A	G	9: 65,704,434	S416P	possibly damaging	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8919:Ptprk	UTSW	10	28483207	nonsense	probably null
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCCTGAGCCAAAGTGAAAG -3'
(R):5'- AGGCCTTCTCAATGTTGGAC -3'

Sequencing Primer
(F):5'- CTGAGCCAAAGTGAAAGGTTTTGTC -3'
(R):5'- CCTTCTCAATGTTGGACTAGAGAG -3'

Posted On

2014-09-17