Incidental Mutation 'R2242:Clca2'
ID240689
Institutional Source Beutler Lab
Gene Symbol Clca2
Ensembl Gene ENSMUSG00000036960
Gene Namechloride channel accessory 2
SynonymsClca5
MMRRC Submission 040242-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2242 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145070263-145099443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145090790 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 219 (S219G)
Ref Sequence ENSEMBL: ENSMUSP00000143161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]
Predicted Effect probably damaging
Transcript: ENSMUST00000040465
AA Change: S219G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: S219G

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
VWA 309 485 3.55e-5 SMART
low complexity region 739 754 N/A INTRINSIC
Blast:FN3 765 875 5e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000198993
AA Change: S219G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960
AA Change: S219G

DomainStartEndE-ValueType
Pfam:CLCA_N 7 265 1.7e-121 PFAM
VWA 309 485 2.2e-7 SMART
Pfam:DUF1973 494 674 7.8e-75 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the calcium-activated chloride channel regulator (CLCR) family of proteins. Members of this family regulate the transport of chloride across the plasma membrane. Expression of this gene is upregulated by the tumor suppressor protein p53 in response to DNA damage. Mice lacking a functional copy of this gene exhibit increased liver weight and hepatocyte hypertrophy. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit increases in liver weight to body weight ratio and hepatocyte hypertrophy; one incidence of multifocal hepatic necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A T 13: 68,689,341 S630T probably benign Het
Afap1l2 T C 19: 56,914,468 I760V possibly damaging Het
Cdc20 A G 4: 118,433,525 V426A probably benign Het
Corin A T 5: 72,332,711 D603E probably damaging Het
Dctn1 A G 6: 83,199,705 Y1205C probably damaging Het
Dync2h1 A T 9: 7,037,828 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Fes T G 7: 80,381,725 E467A probably damaging Het
Ftsj3 T A 11: 106,250,778 Q548L probably benign Het
Gpc6 A T 14: 117,186,787 T96S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lama4 G A 10: 39,026,693 C221Y probably damaging Het
Malrd1 T C 2: 16,101,944 C1856R unknown Het
Mfsd6 G T 1: 52,709,598 P36Q probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr133 A G 17: 38,148,722 I45V possibly damaging Het
Olfr273 A G 4: 52,855,769 V248A probably damaging Het
Ripor2 A G 13: 24,671,772 E65G probably benign Het
Sardh A T 2: 27,235,515 V329E possibly damaging Het
Slc37a3 A G 6: 39,338,805 S446P probably benign Het
Vmn2r57 T C 7: 41,428,074 T223A probably benign Het
Wdr47 A G 3: 108,619,115 D318G probably damaging Het
Zic4 C T 9: 91,378,653 probably benign Het
Other mutations in Clca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca2 APN 3 145098813 missense probably damaging 1.00
IGL01337:Clca2 APN 3 145095178 missense probably damaging 1.00
IGL01389:Clca2 APN 3 145077868 critical splice donor site probably null
IGL01595:Clca2 APN 3 145088007 missense probably damaging 1.00
IGL01704:Clca2 APN 3 145095218 missense probably benign 0.04
IGL02416:Clca2 APN 3 145085016 missense probably benign 0.02
IGL02455:Clca2 APN 3 145081411 missense probably benign 0.00
IGL02481:Clca2 APN 3 145084940 missense possibly damaging 0.92
IGL02526:Clca2 APN 3 145088018 missense probably benign 0.02
IGL02797:Clca2 APN 3 145081263 missense probably benign 0.02
IGL03253:Clca2 APN 3 145071563 missense probably benign 0.41
IGL03256:Clca2 APN 3 145086392 missense possibly damaging 0.75
IGL03294:Clca2 APN 3 145097769 missense probably damaging 1.00
3370:Clca2 UTSW 3 145077977 missense probably damaging 1.00
R0479:Clca2 UTSW 3 145090849 missense probably damaging 1.00
R0542:Clca2 UTSW 3 145075810 splice site probably benign
R0629:Clca2 UTSW 3 145072239 missense probably benign
R1488:Clca2 UTSW 3 145084164 missense possibly damaging 0.49
R1523:Clca2 UTSW 3 145071644 nonsense probably null
R1568:Clca2 UTSW 3 145075649 nonsense probably null
R1650:Clca2 UTSW 3 145092212 missense probably damaging 1.00
R1771:Clca2 UTSW 3 145081410 missense probably benign 0.12
R2101:Clca2 UTSW 3 145077938 missense probably damaging 0.99
R3751:Clca2 UTSW 3 145071455 missense probably benign 0.04
R4496:Clca2 UTSW 3 145092165 missense possibly damaging 0.94
R4962:Clca2 UTSW 3 145077879 missense probably damaging 1.00
R5344:Clca2 UTSW 3 145087942 missense probably damaging 1.00
R5424:Clca2 UTSW 3 145084181 missense probably damaging 0.99
R5931:Clca2 UTSW 3 145092125 missense possibly damaging 0.88
R6181:Clca2 UTSW 3 145090708 nonsense probably null
R6598:Clca2 UTSW 3 145086485 nonsense probably null
R7167:Clca2 UTSW 3 145097784 missense probably benign 0.40
R7229:Clca2 UTSW 3 145084108 missense probably damaging 1.00
R7256:Clca2 UTSW 3 145090847 missense probably damaging 0.99
R7365:Clca2 UTSW 3 145098784 missense probably damaging 1.00
R7813:Clca2 UTSW 3 145084965 missense probably benign 0.26
X0025:Clca2 UTSW 3 145086504 missense possibly damaging 0.87
Z1177:Clca2 UTSW 3 145086451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGCATCCCACTTTGGTC -3'
(R):5'- ACATGTCCACTGAGCTATAATCC -3'

Sequencing Primer
(F):5'- GTCCCTTCCCCAGCTGGAAC -3'
(R):5'- TCCACTGAGCTATAATCCTTAAAAAC -3'
Posted On2014-10-15