Incidental Mutation 'R8371:Clca3a2'
ID 646378
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R8371 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 144807353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 477 (S477*)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably null
Transcript: ENSMUST00000029929
AA Change: S477*
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: S477*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197013
AA Change: S37*
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,054,647 Q1050K probably benign Het
B4galt5 A G 2: 167,309,225 M121T probably damaging Het
Birc3 A G 9: 7,849,426 L549P probably damaging Het
Cacna1b T C 2: 24,720,024 N368S possibly damaging Het
Cbr1 A G 16: 93,609,891 E165G probably damaging Het
Ccdc178 T C 18: 21,811,504 D866G possibly damaging Het
Cd40 G A 2: 165,066,538 G178E probably damaging Het
Cers1 T A 8: 70,329,573 L349H probably benign Het
Chd8 T C 14: 52,232,818 K445R probably benign Het
Clec4a1 T A 6: 122,933,923 *246R probably null Het
CN725425 T C 15: 91,240,770 I171T probably benign Het
Crybg3 A G 16: 59,557,051 M1280T probably benign Het
Csf1r A T 18: 61,117,591 Q458L probably benign Het
Cyp3a11 A T 5: 145,868,628 V193E possibly damaging Het
Cys1 A G 12: 24,668,695 I53T probably benign Het
Dhrs3 A C 4: 144,919,383 probably null Het
Dhx57 T C 17: 80,275,490 R229G probably benign Het
Dhx9 T C 1: 153,456,215 N1336D unknown Het
Dmgdh T A 13: 93,708,730 H410Q probably benign Het
Dmxl1 T A 18: 49,898,714 M2225K probably benign Het
Eif4g3 T G 4: 138,096,845 Y80D probably damaging Het
Ephx4 A T 5: 107,413,518 I164F possibly damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fhl4 G A 10: 85,098,773 A48V probably benign Het
Fmn2 T C 1: 174,609,607 L1048S unknown Het
Gemin5 T C 11: 58,126,558 M1212V probably benign Het
Gm9195 C T 14: 72,460,459 V1294I probably benign Het
Gpr55 A T 1: 85,941,127 V244E probably damaging Het
Hgfac T A 5: 35,045,443 F429Y probably damaging Het
Jade2 T A 11: 51,825,132 E415D probably benign Het
Kcnj4 T A 15: 79,485,141 I213F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Krt82 T C 15: 101,545,111 E280G probably benign Het
Lemd1 C A 1: 132,228,949 Q40K probably damaging Het
Lmo7 T C 14: 101,887,008 L423P possibly damaging Het
Lrp8 A G 4: 107,869,071 Y773C probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mroh8 A T 2: 157,252,976 Y363* probably null Het
Olfr135 G A 17: 38,208,298 A18T probably benign Het
Olfr485 G A 7: 108,159,228 T215I probably benign Het
Olfr559 C A 7: 102,723,583 K302N probably damaging Het
Pcdha2 T C 18: 36,940,263 Y316H possibly damaging Het
Pcdha6 T A 18: 36,969,867 C704* probably null Het
Pik3c2g G A 6: 139,936,056 V923M unknown Het
Rhd A G 4: 134,876,383 S72G probably benign Het
Rhot1 T C 11: 80,243,466 L295P probably damaging Het
Rrp1b A G 17: 32,049,484 E139G possibly damaging Het
Scnn1a T G 6: 125,343,843 Y620D possibly damaging Het
Serpinb12 A T 1: 106,956,405 I294L probably benign Het
Serpinb3d T C 1: 107,080,739 D132G probably damaging Het
Slc26a3 A T 12: 31,452,542 D254V probably damaging Het
Srrm1 A T 4: 135,325,221 I614N unknown Het
Stt3b A G 9: 115,266,175 Y263H probably damaging Het
Taf7 T A 18: 37,643,499 K5I probably damaging Het
Tbck C A 3: 132,752,524 H638Q possibly damaging Het
Tnfsf9 A C 17: 57,105,541 D37A probably benign Het
Trim71 C A 9: 114,515,789 V354F probably benign Het
Tspoap1 T G 11: 87,778,301 C1467G probably benign Het
Xirp1 C T 9: 120,019,433 R128Q possibly damaging Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zfhx2 T C 14: 55,064,092 D2145G probably damaging Het
Zfy2 T C Y: 2,117,168 T220A probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144813686 splice site probably benign
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
R9569:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144797814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGAAAAGGTAACCACATTTTG -3'
(R):5'- CTCATCTTCTGTGGAGTTTAAACAG -3'

Sequencing Primer
(F):5'- GGTAACCACATTTTGTATGACTTCTG -3'
(R):5'- GAAAGTTCACAGCCTGAGTTC -3'
Posted On 2020-09-02