Mutagenetix > Incidental Mutations

Incidental Mutation 'R1114:Aspm'

96982

Institutional Source

Beutler Lab

Gene Symbol

Aspm

Ensembl Gene

ENSMUSG00000033952

Gene Name

abnormal spindle microtubule assembly

Synonyms

Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1

MMRRC Submission

039187-MU

Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139454772-139494091 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 139461924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053364

SMART Domains

Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952

Domain	Start	End	E-Value	Type
Pfam:ASH	29	126	8.9e-35	PFAM
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	2.41e-4	SMART
IQ	1360	1382	2.12e1	SMART
IQ	1387	1408	7.61e1	SMART
IQ	1409	1431	6.97e0	SMART
IQ	1432	1452	1.44e1	SMART
IQ	1453	1475	1.15e-1	SMART
IQ	1476	1495	1.66e2	SMART
IQ	1503	1525	1.65e-2	SMART
IQ	1526	1548	1.32e1	SMART
IQ	1549	1571	1.48e1	SMART
IQ	1572	1594	2.5e1	SMART
IQ	1599	1621	2.58e-4	SMART
IQ	1622	1644	6.7e-3	SMART
IQ	1645	1667	4.25e1	SMART
IQ	1668	1694	1.03e2	SMART
IQ	1695	1717	2.33e-2	SMART
IQ	1718	1740	7.79e0	SMART
IQ	1741	1763	1.57e2	SMART
IQ	1768	1790	2.68e-2	SMART
IQ	1791	1813	5.83e-3	SMART
IQ	1814	1836	5.93e1	SMART
IQ	1841	1863	1.92e-3	SMART
IQ	1864	1886	3.79e-2	SMART
IQ	1914	1936	4.11e0	SMART
IQ	1937	1959	1.87e-1	SMART
IQ	1960	1982	6.27e1	SMART
IQ	1987	2009	8.25e-3	SMART
IQ	2010	2032	5.73e0	SMART
IQ	2060	2082	1.39e0	SMART
IQ	2083	2105	4.62e1	SMART
IQ	2133	2155	5.58e0	SMART
IQ	2156	2178	7.07e-2	SMART
IQ	2206	2228	1.18e-3	SMART
IQ	2229	2251	4.59e0	SMART
IQ	2278	2300	1.85e-5	SMART
IQ	2301	2323	8.13e-2	SMART
IQ	2342	2364	9.62e-4	SMART
IQ	2365	2387	4.12e-3	SMART
IQ	2415	2437	7.58e-2	SMART
IQ	2438	2460	2.6e0	SMART
IQ	2490	2512	1.68e-3	SMART
IQ	2513	2535	8.51e1	SMART
IQ	2560	2582	2.14e-1	SMART
IQ	2601	2623	8.46e0	SMART
IQ	2647	2669	1.15e1	SMART
IQ	2673	2695	1.95e-4	SMART
IQ	2696	2718	4.13e1	SMART
IQ	2723	2745	1.02e-2	SMART
IQ	2761	2783	3.14e2	SMART
IQ	2784	2806	1e1	SMART
IQ	2825	2847	2.43e0	SMART
IQ	2848	2870	4.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197096

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199998

Predicted Effect

probably benign
Transcript: ENSMUST00000200083

SMART Domains

Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

Domain	Start	End	E-Value	Type
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	1.25e1	SMART
IQ	1337	1358	2.96e1	SMART
IQ	1382	1404	1.15e1	SMART
IQ	1408	1430	1.95e-4	SMART
IQ	1431	1453	4.13e1	SMART
IQ	1458	1480	1.02e-2	SMART
IQ	1496	1518	3.14e2	SMART
IQ	1519	1541	1e1	SMART
IQ	1560	1582	2.43e0	SMART
IQ	1583	1605	4.6e-1	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.5%
20x: 84.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	T	A	9: 8,222,178		noncoding transcript	Het
Acss3	T	A	10: 106,988,879	R422S	possibly damaging	Het
Asb15	G	A	6: 24,567,177	R499H	probably damaging	Het
Camk2d	G	A	3: 126,840,292	V488M	probably damaging	Het
Cd247	A	G	1: 165,788,838	K4E	probably benign	Het
Cdh20	A	G	1: 104,979,014	D522G	probably damaging	Het
Cse1l	T	A	2: 166,941,203		probably benign	Het
Dctn2	T	A	10: 127,278,142		probably null	Het
Dpy19l1	A	T	9: 24,424,776	F545I	probably benign	Het
Dpy19l4	A	G	4: 11,287,643		probably benign	Het
Dsg4	A	T	18: 20,466,483	T719S	possibly damaging	Het
Dusp12	A	C	1: 170,881,017	V48G	probably damaging	Het
Efcab7	A	T	4: 99,878,250	R159*	probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fbxw20	A	G	9: 109,223,482	V261A	probably damaging	Het
Gm13078	A	G	4: 143,726,855	I178V	probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Inpp5j	C	A	11: 3,494,814	R953L	possibly damaging	Het
Lrrk2	C	T	15: 91,700,468	R363*	probably null	Het
Ltbp1	A	G	17: 75,360,775	D1089G	probably benign	Het
Luc7l	T	C	17: 26,275,858		probably benign	Het
Mdn1	G	A	4: 32,746,568		probably null	Het
Mgat4a	A	T	1: 37,464,406		probably benign	Het
Mmp12	A	G	9: 7,358,289	T392A	possibly damaging	Het
Nlrp12	A	G	7: 3,228,534	V921A	probably benign	Het
Olfr1030	A	T	2: 85,984,307	I156F	probably benign	Het
Olfr1086	G	A	2: 86,677,285	T16I	possibly damaging	Het
Olfr765	T	A	10: 129,046,842	I74F	possibly damaging	Het
Pkd2l1	T	C	19: 44,191,544		probably benign	Het
Rictor	C	A	15: 6,794,005	C1554*	probably null	Het
Ryr2	A	G	13: 11,945,981	C24R	probably damaging	Het
Scamp2	T	A	9: 57,581,580	I188N	probably damaging	Het
Smg1	A	T	7: 118,159,790		probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Ssfa2	A	G	2: 79,657,529	E652G	probably damaging	Het
Synrg	C	A	11: 84,023,436		probably benign	Het
Syt9	G	T	7: 107,425,355	V152F	possibly damaging	Het
Trmt2a	A	G	16: 18,250,440		probably benign	Het
Vmn2r100	T	C	17: 19,531,999	I831T	probably damaging	Het
Vps13a	G	T	19: 16,750,151	H196N	probably benign	Het
Xdh	T	C	17: 73,941,149		probably benign	Het

Other mutations in Aspm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Aspm	APN	1	139478691	missense	probably damaging	1.00
IGL00594:Aspm	APN	1	139487422	splice site	probably benign
IGL00808:Aspm	APN	1	139461476	missense	probably benign	0.03
IGL00897:Aspm	APN	1	139477407	missense	probably damaging	0.98
IGL01024:Aspm	APN	1	139478124	missense	possibly damaging	0.66
IGL01410:Aspm	APN	1	139482444	missense	probably benign	0.25
IGL01588:Aspm	APN	1	139478162	missense	probably benign	0.11
IGL01610:Aspm	APN	1	139489670	nonsense	probably null
IGL01633:Aspm	APN	1	139480836	missense	possibly damaging	0.93
IGL01982:Aspm	APN	1	139491588	missense	probably benign	0.12
IGL02429:Aspm	APN	1	139479810	missense	probably benign	0.27
IGL02468:Aspm	APN	1	139480950	missense	probably damaging	1.00
IGL02519:Aspm	APN	1	139461927	splice site	probably benign
IGL02526:Aspm	APN	1	139489719	missense	probably benign	0.03
IGL02716:Aspm	APN	1	139479687	missense	probably damaging	1.00
IGL02876:Aspm	APN	1	139473653	missense	probably damaging	1.00
IGL02953:Aspm	APN	1	139457419	missense	probably benign	0.01
IGL03275:Aspm	APN	1	139487295	missense	probably damaging	1.00
Stemware	UTSW	1	139477459	nonsense	probably null
3-1:Aspm	UTSW	1	139457541	missense	probably benign
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0140:Aspm	UTSW	1	139480641	missense	probably benign	0.00
R0195:Aspm	UTSW	1	139479135	missense	probably damaging	1.00
R0217:Aspm	UTSW	1	139457880	missense	possibly damaging	0.46
R0276:Aspm	UTSW	1	139478471	missense	possibly damaging	0.95
R0309:Aspm	UTSW	1	139482511	splice site	probably benign
R0466:Aspm	UTSW	1	139477901	missense	probably damaging	1.00
R0520:Aspm	UTSW	1	139478820	missense	possibly damaging	0.51
R0615:Aspm	UTSW	1	139487289	missense	probably damaging	1.00
R0626:Aspm	UTSW	1	139491601	missense	probably damaging	1.00
R0660:Aspm	UTSW	1	139457764	missense	probably benign	0.03
R0751:Aspm	UTSW	1	139456898	splice site	probably benign
R0830:Aspm	UTSW	1	139474254	missense	probably damaging	0.99
R1109:Aspm	UTSW	1	139456758	missense	probably damaging	0.99
R1130:Aspm	UTSW	1	139477834	missense	possibly damaging	0.90
R1298:Aspm	UTSW	1	139457419	missense	probably benign	0.01
R1386:Aspm	UTSW	1	139457623	missense	probably benign	0.03
R1386:Aspm	UTSW	1	139478972	missense	possibly damaging	0.80
R1557:Aspm	UTSW	1	139468668	missense	probably benign	0.01
R1625:Aspm	UTSW	1	139481039	missense	probably benign	0.01
R1728:Aspm	UTSW	1	139473574	missense	probably benign
R1729:Aspm	UTSW	1	139473574	missense	probably benign
R1730:Aspm	UTSW	1	139473574	missense	probably benign
R1733:Aspm	UTSW	1	139457117	missense	probably benign	0.27
R1739:Aspm	UTSW	1	139473574	missense	probably benign
R1762:Aspm	UTSW	1	139473574	missense	probably benign
R1783:Aspm	UTSW	1	139473574	missense	probably benign
R1784:Aspm	UTSW	1	139473574	missense	probably benign
R1785:Aspm	UTSW	1	139473574	missense	probably benign
R1793:Aspm	UTSW	1	139457341	missense	probably benign	0.00
R1893:Aspm	UTSW	1	139479867	missense	probably damaging	1.00
R1911:Aspm	UTSW	1	139478094	missense	probably benign	0.06
R2103:Aspm	UTSW	1	139491665	missense	probably damaging	0.99
R2128:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2129:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2239:Aspm	UTSW	1	139456846	missense	possibly damaging	0.67
R2352:Aspm	UTSW	1	139457562	missense	probably benign	0.02
R2353:Aspm	UTSW	1	139477697	missense	probably damaging	1.00
R2380:Aspm	UTSW	1	139479348	missense	probably damaging	1.00
R2413:Aspm	UTSW	1	139477757	missense	probably damaging	1.00
R2421:Aspm	UTSW	1	139488487	missense	possibly damaging	0.49
R3607:Aspm	UTSW	1	139480668	missense	probably benign	0.13
R3711:Aspm	UTSW	1	139458100	missense	probably benign	0.17
R3718:Aspm	UTSW	1	139480889	missense	probably benign	0.09
R3718:Aspm	UTSW	1	139490427	missense	probably benign	0.31
R3741:Aspm	UTSW	1	139478619	missense	possibly damaging	0.47
R3788:Aspm	UTSW	1	139463203	missense	probably damaging	1.00
R3838:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3839:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3849:Aspm	UTSW	1	139458286	missense	probably benign	0.21
R4075:Aspm	UTSW	1	139474285	missense	probably damaging	1.00
R4080:Aspm	UTSW	1	139470755	missense	probably damaging	1.00
R4463:Aspm	UTSW	1	139455010	missense	possibly damaging	0.95
R4537:Aspm	UTSW	1	139474303	missense	probably benign	0.01
R4547:Aspm	UTSW	1	139478187	missense	possibly damaging	0.75
R4573:Aspm	UTSW	1	139479507	missense	probably damaging	0.98
R4680:Aspm	UTSW	1	139480671	missense	probably benign	0.05
R4807:Aspm	UTSW	1	139477919	missense	probably damaging	1.00
R4840:Aspm	UTSW	1	139470531	missense	possibly damaging	0.83
R4854:Aspm	UTSW	1	139478072	nonsense	probably null
R4859:Aspm	UTSW	1	139469393	missense	probably damaging	1.00
R4893:Aspm	UTSW	1	139489839	critical splice donor site	probably null
R4910:Aspm	UTSW	1	139491543	missense	probably damaging	1.00
R4953:Aspm	UTSW	1	139471734	missense	probably benign	0.00
R4974:Aspm	UTSW	1	139478010	missense	probably benign	0.03
R4981:Aspm	UTSW	1	139470760	splice site	probably null
R5082:Aspm	UTSW	1	139478676	nonsense	probably null
R5223:Aspm	UTSW	1	139478334	missense	probably damaging	1.00
R5268:Aspm	UTSW	1	139464295	missense	probably damaging	1.00
R5371:Aspm	UTSW	1	139470541	nonsense	probably null
R5377:Aspm	UTSW	1	139457483	missense	probably damaging	0.96
R5377:Aspm	UTSW	1	139470395	splice site	probably null
R5481:Aspm	UTSW	1	139457061	missense	possibly damaging	0.85
R5513:Aspm	UTSW	1	139482398	missense	probably damaging	1.00
R5578:Aspm	UTSW	1	139470717	missense	probably damaging	1.00
R5649:Aspm	UTSW	1	139479669	missense	probably benign
R5685:Aspm	UTSW	1	139487288	missense	probably benign	0.10
R5695:Aspm	UTSW	1	139479669	missense	probably benign
R5766:Aspm	UTSW	1	139479002	missense	probably damaging	0.99
R5964:Aspm	UTSW	1	139455227	intron	probably benign
R5993:Aspm	UTSW	1	139479531	missense	probably benign	0.28
R6027:Aspm	UTSW	1	139463056	missense	probably damaging	1.00
R6029:Aspm	UTSW	1	139480990	missense	possibly damaging	0.83
R6102:Aspm	UTSW	1	139477459	nonsense	probably null
R6188:Aspm	UTSW	1	139479239	missense	possibly damaging	0.79
R6257:Aspm	UTSW	1	139482053	splice site	probably null
R6433:Aspm	UTSW	1	139473683	missense	probably damaging	1.00
R6682:Aspm	UTSW	1	139457722	missense	possibly damaging	0.67
R6763:Aspm	UTSW	1	139470517	missense	possibly damaging	0.64
R6798:Aspm	UTSW	1	139468685	missense	possibly damaging	0.66
R6815:Aspm	UTSW	1	139480142	missense	probably benign	0.04
R6854:Aspm	UTSW	1	139463182	missense	possibly damaging	0.90
R6928:Aspm	UTSW	1	139480206	nonsense	probably null
R6943:Aspm	UTSW	1	139480542	missense	probably damaging	1.00
R6979:Aspm	UTSW	1	139480485	missense	probably damaging	1.00
R6998:Aspm	UTSW	1	139469472	missense	probably damaging	1.00
R7126:Aspm	UTSW	1	139480803	missense	probably benign	0.27
R7237:Aspm	UTSW	1	139477929	missense	possibly damaging	0.81
R7240:Aspm	UTSW	1	139478651	nonsense	probably null
R7272:Aspm	UTSW	1	139458328	missense	probably benign	0.14
R7427:Aspm	UTSW	1	139457616	missense	probably benign	0.01
R7519:Aspm	UTSW	1	139490336	missense	possibly damaging	0.53
R7776:Aspm	UTSW	1	139479846	missense	possibly damaging	0.85
R7875:Aspm	UTSW	1	139455134	missense	probably benign	0.02
R7883:Aspm	UTSW	1	139478667	missense	possibly damaging	0.47
R7964:Aspm	UTSW	1	139480686	missense	probably damaging	1.00
R8012:Aspm	UTSW	1	139457464	missense	probably benign	0.03
R8029:Aspm	UTSW	1	139471632	missense	probably benign	0.00
R8233:Aspm	UTSW	1	139457304	missense	probably benign	0.28
R8277:Aspm	UTSW	1	139455010	missense	probably damaging	1.00
R8345:Aspm	UTSW	1	139464273	nonsense	probably null
R8491:Aspm	UTSW	1	139457695	missense	probably damaging	0.98
R8511:Aspm	UTSW	1	139457308	missense	probably damaging	1.00
R8557:Aspm	UTSW	1	139456756	missense	probably benign	0.01
R8927:Aspm	UTSW	1	139490387	nonsense	probably null
R8928:Aspm	UTSW	1	139490387	nonsense	probably null
R8950:Aspm	UTSW	1	139478952	missense	probably damaging	1.00
R9033:Aspm	UTSW	1	139478127	missense	probably damaging	1.00
R9083:Aspm	UTSW	1	139493698	missense	possibly damaging	0.70
R9133:Aspm	UTSW	1	139491528	missense	probably damaging	1.00
R9160:Aspm	UTSW	1	139490124	missense	probably damaging	1.00
R9179:Aspm	UTSW	1	139476715	missense	probably damaging	1.00
R9265:Aspm	UTSW	1	139461444	missense	probably benign	0.24
R9400:Aspm	UTSW	1	139479903	missense	probably damaging	1.00
R9419:Aspm	UTSW	1	139457185	missense	probably benign	0.29
X0063:Aspm	UTSW	1	139458090	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTCTCTTCAGCACAGAGTGACAGC -3'
(R):5'- CCAGGGCAACAATCGAGTTTCCTTC -3'

Sequencing Primer
(F):5'- CAGCAAACATTGTTCAGTGGC -3'
(R):5'- AGTTTCCTTCTCAAGAAGAGGTTCC -3'

Posted On

2014-01-05