Mutagenetix > Incidental Mutations

Incidental Mutation 'R2974:Dpp10'

255305

Institutional Source

Beutler Lab

Gene Symbol

Dpp10

Ensembl Gene

ENSMUSG00000036815

Gene Name

dipeptidylpeptidase 10

Synonyms

6430601K09Rik, DPRP3

MMRRC Submission

040527-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2974 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123321471-124045559 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 123411705 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]

Predicted Effect

probably benign
Transcript: ENSMUST00000112603

SMART Domains

Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
Pfam:DPPIV_N	83	450	4.9e-118	PFAM
Pfam:Peptidase_S9	530	734	6.4e-47	PFAM
Pfam:DLH	556	711	1.4e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112606

SMART Domains

Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	64	79	N/A	INTRINSIC
Pfam:DPPIV_N	137	504	4.4e-115	PFAM
Pfam:Peptidase_S9	584	788	8.6e-48	PFAM
Pfam:DLH	604	774	1.1e-7	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	T	C	2: 148,850,786	D32G	probably benign	Het
Abca7	T	G	10: 80,008,967	F1508V	probably damaging	Het
BC048507	T	C	13: 67,863,630	I42T	probably benign	Het
Cop1	A	G	1: 159,324,929	H583R	possibly damaging	Het
Crnkl1	A	G	2: 145,932,261	L94P	probably benign	Het
Ctu1	A	G	7: 43,675,650		probably benign	Het
D930007J09Rik	C	T	13: 32,802,759		probably benign	Het
Depdc5	T	C	5: 32,934,017		probably null	Het
Dnah14	A	T	1: 181,755,241		probably null	Het
Doxl2	A	G	6: 48,976,424	T428A	probably benign	Het
Gm13757	A	T	2: 88,446,574	C121*	probably null	Het
Gsdme	A	G	6: 50,229,324	C180R	probably damaging	Het
Gse1	C	A	8: 120,570,897		probably benign	Het
Med15	T	C	16: 17,652,711	Y744C	probably damaging	Het
Nlrp4d	A	G	7: 10,378,440		probably benign	Het
Nyap2	C	T	1: 81,191,770	R81*	probably null	Het
Olfr948	T	C	9: 39,318,996	N206S	probably damaging	Het
Phax	T	A	18: 56,573,062	M8K	probably benign	Het
Plec	C	G	15: 76,188,761	G631R	probably damaging	Het
Rgs3	A	T	4: 62,640,720	T476S	probably damaging	Het
Rogdi	G	T	16: 5,011,662	Q90K	probably damaging	Het
Rxrg	G	A	1: 167,639,146	R422H	probably damaging	Het
Serpinb9e	T	A	13: 33,255,143	V184E	probably benign	Het
Simc1	A	G	13: 54,550,461	D397G	probably damaging	Het
Slc25a27	T	C	17: 43,653,371	N203D	probably damaging	Het
Slit1	G	A	19: 41,611,016	P1032L	probably benign	Het
Sptlc3	A	G	2: 139,589,661	T368A	probably damaging	Het
Tnip1	C	T	11: 54,933,983		probably benign	Het
Tpgs1	A	G	10: 79,669,615	E69G	probably damaging	Het
Trpv5	T	C	6: 41,653,231	S642G	possibly damaging	Het
Ube2d2a	T	A	18: 35,800,172	D87E	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,856	V798A	probably damaging	Het
Vmn2r77	T	C	7: 86,803,685	Y537H	probably benign	Het

Other mutations in Dpp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Dpp10	APN	1	123334370	missense	probably damaging	1.00
IGL01618:Dpp10	APN	1	123367867	missense	probably benign
IGL02101:Dpp10	APN	1	123411826	missense	probably damaging	1.00
IGL02284:Dpp10	APN	1	124045366	splice site	probably benign
IGL02324:Dpp10	APN	1	123367802	missense	probably benign	0.02
IGL02391:Dpp10	APN	1	123650358	missense	probably damaging	0.98
IGL02458:Dpp10	APN	1	123341689	missense	probably benign	0.01
IGL02469:Dpp10	APN	1	123411803	missense	probably benign	0.01
IGL02501:Dpp10	APN	1	123686270	missense	possibly damaging	0.93
IGL02522:Dpp10	APN	1	123423652	missense	probably benign	0.24
IGL02672:Dpp10	APN	1	123376647	missense	probably benign	0.45
IGL03034:Dpp10	APN	1	123341619	missense	probably damaging	1.00
PIT1430001:Dpp10	UTSW	1	123341182	splice site	probably benign
R0104:Dpp10	UTSW	1	123367843	missense	probably benign	0.00
R0114:Dpp10	UTSW	1	123486092	missense	probably benign	0.07
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0682:Dpp10	UTSW	1	123905125	missense	probably damaging	0.98
R0815:Dpp10	UTSW	1	123432929	critical splice donor site	probably null
R1549:Dpp10	UTSW	1	123341380	critical splice acceptor site	probably null
R1742:Dpp10	UTSW	1	123445206	missense	probably damaging	1.00
R1859:Dpp10	UTSW	1	123353604	missense	possibly damaging	0.47
R1991:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R1992:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R2079:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
R2882:Dpp10	UTSW	1	123445203	missense	probably damaging	1.00
R3827:Dpp10	UTSW	1	123411790	missense	possibly damaging	0.56
R3852:Dpp10	UTSW	1	123485924	nonsense	probably null
R3876:Dpp10	UTSW	1	123353487	missense	probably damaging	0.98
R3899:Dpp10	UTSW	1	123353557	missense	probably damaging	1.00
R4735:Dpp10	UTSW	1	123398627	missense	probably benign	0.15
R4922:Dpp10	UTSW	1	123378153	missense	probably benign	0.44
R5457:Dpp10	UTSW	1	123411810	missense	possibly damaging	0.51
R5599:Dpp10	UTSW	1	123905076	missense	probably damaging	0.99
R5913:Dpp10	UTSW	1	123384289	missense	probably damaging	1.00
R5979:Dpp10	UTSW	1	123384283	critical splice donor site	probably null
R6378:Dpp10	UTSW	1	123411739	missense	probably damaging	1.00
R6429:Dpp10	UTSW	1	123367601	missense	possibly damaging	0.72
R6505:Dpp10	UTSW	1	123336851	missense	probably damaging	0.99
R6776:Dpp10	UTSW	1	123367656	nonsense	probably null
R6894:Dpp10	UTSW	1	123336864	missense	probably damaging	1.00
R6951:Dpp10	UTSW	1	123341650	missense	possibly damaging	0.93
R7182:Dpp10	UTSW	1	123341151	missense	probably benign	0.15
R7246:Dpp10	UTSW	1	123334377	missense	probably damaging	1.00
R7297:Dpp10	UTSW	1	123353428	nonsense	probably null
R7375:Dpp10	UTSW	1	123367795	missense	probably benign
R7387:Dpp10	UTSW	1	123341140	missense	probably benign	0.01
R7661:Dpp10	UTSW	1	123384952	missense	probably damaging	1.00
R8065:Dpp10	UTSW	1	123352660	missense	probably benign
R8067:Dpp10	UTSW	1	123352660	missense	probably benign
R8260:Dpp10	UTSW	1	123686295	missense	probably benign
R8324:Dpp10	UTSW	1	123854172	missense	probably benign	0.02
R8373:Dpp10	UTSW	1	123854229	missense	possibly damaging	0.94
R8434:Dpp10	UTSW	1	123433010	missense	probably damaging	1.00
X0019:Dpp10	UTSW	1	123398585	missense	possibly damaging	0.88
X0020:Dpp10	UTSW	1	123398582	missense	probably benign	0.36
X0021:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
X0024:Dpp10	UTSW	1	123384286	missense	probably damaging	1.00
Z1176:Dpp10	UTSW	1	123353440	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGTGGAAAATGGCTCATACTC -3'
(R):5'- GAAAAGTCAAGTGTAGGCTAGTTTC -3'

Sequencing Primer
(F):5'- CTGAGACCCTTCCTCAGTCAGAAAG -3'
(R):5'- TTGCATCTAAAACAACACATGATTC -3'

Posted On

2014-12-29