Mutagenetix > Incidental Mutation

Incidental Mutation 'R8067:Dpp10'

620040

Institutional Source

Beutler Lab

Gene Symbol

Dpp10

Ensembl Gene

ENSMUSG00000036815

Gene Name

dipeptidylpeptidase 10

Synonyms

6430601K09Rik, DPRP3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8067 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123321471-124045559 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123352660 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 646 (S646P)

Ref Sequence

ENSEMBL: ENSMUSP00000108225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000112603
AA Change: S635P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: S635P

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
Pfam:DPPIV_N	83	450	4.9e-118	PFAM
Pfam:Peptidase_S9	530	734	6.4e-47	PFAM
Pfam:DLH	556	711	1.4e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112606
AA Change: S646P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: S646P

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	64	79	N/A	INTRINSIC
Pfam:DPPIV_N	137	504	4.4e-115	PFAM
Pfam:Peptidase_S9	584	788	8.6e-48	PFAM
Pfam:DLH	604	774	1.1e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	A	T	8: 13,558,643	D145E	possibly damaging	Het
Adcy7	T	C	8: 88,311,069	L255P	probably damaging	Het
Cbx7	A	T	15: 79,933,898	V1D	unknown	Het
Cd209c	A	C	8: 3,945,700	M34R	probably benign	Het
Chodl	A	T	16: 78,946,713	L229F	probably damaging	Het
Depdc5	C	A	5: 32,895,908	N197K	possibly damaging	Het
Dnaic1	T	A	4: 41,614,258	D311E	probably damaging	Het
Dopey1	A	G	9: 86,518,339	Y1017C	probably benign	Het
Dopey2	T	A	16: 93,765,448	L927*	probably null	Het
Ebf1	G	A	11: 44,620,547	V90M	probably benign	Het
Efhd1	C	T	1: 87,264,591	P48S	probably benign	Het
Fam208b	C	T	13: 3,569,602	V2210I	probably benign	Het
Fam83b	T	C	9: 76,491,098	T908A	probably benign	Het
Fbxl16	G	A	17: 25,817,983	V313I	probably damaging	Het
Git2	C	T	5: 114,766,518	M113I	probably damaging	Het
Gpr87	T	A	3: 59,179,887	I66F	probably damaging	Het
H60c	A	C	10: 3,259,338	L217V	unknown	Het
Iba57	T	C	11: 59,163,260		probably benign	Het
Igkv11-125	C	A	6: 67,913,830	T44N	probably benign	Het
Itih2	T	A	2: 10,123,483	I136F	probably damaging	Het
Itpr3	T	A	17: 27,110,862	D1543E	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk	A	T	16: 34,972,019	E1570V	probably benign	Het
N4bp2	T	A	5: 65,807,296	L896H	probably damaging	Het
Ndc1	T	A	4: 107,390,398	S468T	probably benign	Het
Ndst3	T	C	3: 123,601,445	N512S	probably damaging	Het
Olfr1138	T	A	2: 87,737,803	I174F	probably damaging	Het
Olfr65	A	G	7: 103,906,403		probably benign	Het
Plekhn1	T	C	4: 156,228,240	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,715,652	E350G	probably null	Het
Prpf8	T	C	11: 75,500,150	W1342R	probably damaging	Het
Pum1	T	C	4: 130,751,525	V486A	possibly damaging	Het
Rin2	T	G	2: 145,861,057	S558A	probably damaging	Het
Ripk4	A	T	16: 97,763,537	V58D	probably damaging	Het
Smyd3	A	G	1: 179,410,463	M113T	possibly damaging	Het
Spock1	A	T	13: 57,696,171		probably null	Het
Srgap3	C	T	6: 112,739,364	R625H	probably benign	Het
Tmed2	T	C	5: 124,546,923	I134T	possibly damaging	Het
Washc2	T	A	6: 116,224,503	S353R	probably damaging	Het
Xdh	T	A	17: 73,900,657	R902W	probably benign	Het
Zbtb5	A	T	4: 44,994,972	S137R	probably benign	Het
Zfp286	A	T	11: 62,753,519	I192K	unknown	Het
Zfp942	T	C	17: 21,930,410	Y38C	probably damaging	Het
Zfpm1	T	C	8: 122,335,584	S461P	probably benign	Het

Other mutations in Dpp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Dpp10	APN	1	123334370	missense	probably damaging	1.00
IGL01618:Dpp10	APN	1	123367867	missense	probably benign
IGL02101:Dpp10	APN	1	123411826	missense	probably damaging	1.00
IGL02284:Dpp10	APN	1	124045366	splice site	probably benign
IGL02324:Dpp10	APN	1	123367802	missense	probably benign	0.02
IGL02391:Dpp10	APN	1	123650358	missense	probably damaging	0.98
IGL02458:Dpp10	APN	1	123341689	missense	probably benign	0.01
IGL02469:Dpp10	APN	1	123411803	missense	probably benign	0.01
IGL02501:Dpp10	APN	1	123686270	missense	possibly damaging	0.93
IGL02522:Dpp10	APN	1	123423652	missense	probably benign	0.24
IGL02672:Dpp10	APN	1	123376647	missense	probably benign	0.45
IGL03034:Dpp10	APN	1	123341619	missense	probably damaging	1.00
PIT1430001:Dpp10	UTSW	1	123341182	splice site	probably benign
R0104:Dpp10	UTSW	1	123367843	missense	probably benign	0.00
R0114:Dpp10	UTSW	1	123486092	missense	probably benign	0.07
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0682:Dpp10	UTSW	1	123905125	missense	probably damaging	0.98
R0815:Dpp10	UTSW	1	123432929	critical splice donor site	probably null
R1549:Dpp10	UTSW	1	123341380	critical splice acceptor site	probably null
R1742:Dpp10	UTSW	1	123445206	missense	probably damaging	1.00
R1859:Dpp10	UTSW	1	123353604	missense	possibly damaging	0.47
R1991:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R1992:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R2079:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
R2882:Dpp10	UTSW	1	123445203	missense	probably damaging	1.00
R2974:Dpp10	UTSW	1	123411705	splice site	probably benign
R3827:Dpp10	UTSW	1	123411790	missense	possibly damaging	0.56
R3852:Dpp10	UTSW	1	123485924	nonsense	probably null
R3876:Dpp10	UTSW	1	123353487	missense	probably damaging	0.98
R3899:Dpp10	UTSW	1	123353557	missense	probably damaging	1.00
R4735:Dpp10	UTSW	1	123398627	missense	probably benign	0.15
R4922:Dpp10	UTSW	1	123378153	missense	probably benign	0.44
R5457:Dpp10	UTSW	1	123411810	missense	possibly damaging	0.51
R5599:Dpp10	UTSW	1	123905076	missense	probably damaging	0.99
R5913:Dpp10	UTSW	1	123384289	missense	probably damaging	1.00
R5979:Dpp10	UTSW	1	123384283	critical splice donor site	probably null
R6378:Dpp10	UTSW	1	123411739	missense	probably damaging	1.00
R6429:Dpp10	UTSW	1	123367601	missense	possibly damaging	0.72
R6505:Dpp10	UTSW	1	123336851	missense	probably damaging	0.99
R6776:Dpp10	UTSW	1	123367656	nonsense	probably null
R6894:Dpp10	UTSW	1	123336864	missense	probably damaging	1.00
R6951:Dpp10	UTSW	1	123341650	missense	possibly damaging	0.93
R7182:Dpp10	UTSW	1	123341151	missense	probably benign	0.15
R7246:Dpp10	UTSW	1	123334377	missense	probably damaging	1.00
R7297:Dpp10	UTSW	1	123353428	nonsense	probably null
R7375:Dpp10	UTSW	1	123367795	missense	probably benign
R7387:Dpp10	UTSW	1	123341140	missense	probably benign	0.01
R7661:Dpp10	UTSW	1	123384952	missense	probably damaging	1.00
R8065:Dpp10	UTSW	1	123352660	missense	probably benign
R8260:Dpp10	UTSW	1	123686295	missense	probably benign
R8324:Dpp10	UTSW	1	123854172	missense	probably benign	0.02
R8373:Dpp10	UTSW	1	123854229	missense	possibly damaging	0.94
R8434:Dpp10	UTSW	1	123433010	missense	probably damaging	1.00
R9068:Dpp10	UTSW	1	123432938	missense	probably damaging	1.00
R9104:Dpp10	UTSW	1	123411755	missense	probably damaging	1.00
R9477:Dpp10	UTSW	1	123376641	missense	possibly damaging	0.46
R9492:Dpp10	UTSW	1	123353430	missense	probably damaging	1.00
R9524:Dpp10	UTSW	1	123336882	missense	probably damaging	1.00
R9576:Dpp10	UTSW	1	123341680	missense	probably damaging	1.00
R9631:Dpp10	UTSW	1	123341703	missense	probably damaging	1.00
R9736:Dpp10	UTSW	1	123334359	missense	possibly damaging	0.64
X0019:Dpp10	UTSW	1	123398585	missense	possibly damaging	0.88
X0020:Dpp10	UTSW	1	123398582	missense	probably benign	0.36
X0021:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
X0024:Dpp10	UTSW	1	123384286	missense	probably damaging	1.00
Z1176:Dpp10	UTSW	1	123353440	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATGCTTGAGAAGTAACCTTCC -3'
(R):5'- TGTGTGTAAATGTGAGAAGCAATGC -3'

Sequencing Primer
(F):5'- ACCTTCCAAATAATTGACAGAATGG -3'
(R):5'- ACCATCAACTTTGGGGTCAG -3'

Posted On

2020-01-23