Incidental Mutation 'R3176:Dmbt1'
ID 259139
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin
MMRRC Submission 040614-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R3176 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 130633787-130723357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130689801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 715 (T715A)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: T878A
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: T878A

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: T889A
Predicted Effect probably benign
Transcript: ENSMUST00000213064
AA Change: T715A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 87,233,495 (GRCm39) R1269H probably damaging Het
Ace A G 11: 105,867,528 (GRCm39) E164G probably null Het
Als2 A T 1: 59,209,167 (GRCm39) V1464E possibly damaging Het
Atox1 A G 11: 55,341,379 (GRCm39) L52P possibly damaging Het
Btnl10 A G 11: 58,813,216 (GRCm39) K282E probably benign Het
Cdkn3 T C 14: 47,008,934 (GRCm39) probably benign Het
Ces2a A G 8: 105,466,010 (GRCm39) probably benign Het
Col16a1 A G 4: 129,951,792 (GRCm39) K72E probably damaging Het
Col6a5 G A 9: 105,788,306 (GRCm39) R1565* probably null Het
Col6a6 T C 9: 105,663,429 (GRCm39) H36R probably benign Het
Cyp4b1 T C 4: 115,483,047 (GRCm39) N415D possibly damaging Het
Dcp1a A G 14: 30,227,499 (GRCm39) probably benign Het
Dennd4a G T 9: 64,796,275 (GRCm39) R767L probably damaging Het
Dhcr24 T C 4: 106,418,436 (GRCm39) F25L probably benign Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Dhx58 A G 11: 100,587,805 (GRCm39) F584S probably damaging Het
Dtx3l A G 16: 35,752,543 (GRCm39) S688P probably benign Het
Eogt T A 6: 97,108,355 (GRCm39) I229F probably benign Het
Ern2 T C 7: 121,780,187 (GRCm39) T164A possibly damaging Het
Fam133b A T 5: 3,608,522 (GRCm39) N84I probably damaging Het
Fbxl21 T A 13: 56,684,935 (GRCm39) Y346* probably null Het
Fcgbp C A 7: 27,791,086 (GRCm39) H782Q probably damaging Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hao2 T C 3: 98,787,644 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Itgav A G 2: 83,606,886 (GRCm39) D409G probably damaging Het
Kcnt2 A G 1: 140,537,377 (GRCm39) N1119S probably benign Het
Kif15 T C 9: 122,816,905 (GRCm39) probably benign Het
Klhl32 T C 4: 24,682,063 (GRCm39) I207V probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lhfpl5 T C 17: 28,798,920 (GRCm39) I143T possibly damaging Het
Lrrk1 T C 7: 65,955,269 (GRCm39) K431E possibly damaging Het
Mag C T 7: 30,601,073 (GRCm39) probably null Het
Maml3 A T 3: 51,764,351 (GRCm39) N204K possibly damaging Het
Mmut A G 17: 41,269,763 (GRCm39) probably null Het
Mrpl19 T C 6: 81,941,047 (GRCm39) S115G probably damaging Het
Mthfd1l G C 10: 4,098,025 (GRCm39) G954A probably damaging Het
Myo19 A G 11: 84,783,001 (GRCm39) I172V probably benign Het
Naca T C 10: 127,876,530 (GRCm39) probably benign Het
Nbeal2 G A 9: 110,465,955 (GRCm39) probably benign Het
Nfatc2 T C 2: 168,348,914 (GRCm39) N638D possibly damaging Het
Or52r1c C A 7: 102,734,957 (GRCm39) D72E probably damaging Het
Or8b49 T A 9: 38,505,939 (GRCm39) C141S probably damaging Het
Or9s27 A G 1: 92,516,535 (GRCm39) N161S probably benign Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Prcd A G 11: 116,550,637 (GRCm39) E103G possibly damaging Het
Prkx A T X: 76,814,881 (GRCm39) F260I probably damaging Het
Rad54l2 A G 9: 106,631,142 (GRCm39) probably null Het
Rb1cc1 T A 1: 6,319,590 (GRCm39) M1003K probably benign Het
Scap A T 9: 110,203,093 (GRCm39) M256L probably benign Het
Sema4c C T 1: 36,588,960 (GRCm39) R722H possibly damaging Het
Septin4 T C 11: 87,458,070 (GRCm39) V148A possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Sp110 A C 1: 85,505,050 (GRCm39) F434C probably benign Het
Spata7 A G 12: 98,603,857 (GRCm39) N75D possibly damaging Het
Tmem120b T A 5: 123,252,167 (GRCm39) I146N probably damaging Het
Ttc23l A G 15: 10,547,318 (GRCm39) F99L possibly damaging Het
Ube3a T A 7: 58,926,267 (GRCm39) C348* probably null Het
Ubr4 T A 4: 139,149,166 (GRCm39) D1777E probably benign Het
Unc79 C A 12: 103,079,476 (GRCm39) D1880E probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 130,681,270 (GRCm39) intron probably benign
IGL00161:Dmbt1 APN 7 130,711,357 (GRCm39) missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 130,701,020 (GRCm39) missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 130,684,230 (GRCm39) missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 130,699,337 (GRCm39) missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 130,659,888 (GRCm39) missense probably benign 0.26
IGL01072:Dmbt1 APN 7 130,687,098 (GRCm39) splice site probably benign
IGL01317:Dmbt1 APN 7 130,642,921 (GRCm39) missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 130,690,497 (GRCm39) missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 130,705,409 (GRCm39) missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 130,718,457 (GRCm39) missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 130,682,915 (GRCm39) missense probably benign 0.14
IGL01890:Dmbt1 APN 7 130,676,149 (GRCm39) intron probably benign
IGL02160:Dmbt1 APN 7 130,684,418 (GRCm39) missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 130,694,986 (GRCm39) splice site probably benign
IGL02197:Dmbt1 APN 7 130,687,152 (GRCm39) splice site probably benign
IGL02332:Dmbt1 APN 7 130,668,343 (GRCm39) intron probably benign
IGL02427:Dmbt1 APN 7 130,689,815 (GRCm39) splice site probably null
IGL02726:Dmbt1 APN 7 130,676,140 (GRCm39) intron probably benign
IGL02967:Dmbt1 APN 7 130,672,919 (GRCm39) missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 130,684,409 (GRCm39) missense probably benign 0.05
IGL03089:Dmbt1 APN 7 130,712,778 (GRCm39) missense probably damaging 0.99
cavity UTSW 7 130,713,965 (GRCm39) missense unknown
lacunar UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
BB015:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
H8562:Dmbt1 UTSW 7 130,713,805 (GRCm39) nonsense probably null
K3955:Dmbt1 UTSW 7 130,721,293 (GRCm39) missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 130,708,123 (GRCm39) missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 130,697,779 (GRCm39) splice site probably benign
R0427:Dmbt1 UTSW 7 130,642,632 (GRCm39) nonsense probably null
R0478:Dmbt1 UTSW 7 130,642,917 (GRCm39) missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 130,699,403 (GRCm39) splice site probably null
R0538:Dmbt1 UTSW 7 130,651,631 (GRCm39) splice site probably benign
R0626:Dmbt1 UTSW 7 130,703,811 (GRCm39) missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 130,699,383 (GRCm39) missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 130,694,847 (GRCm39) missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 130,676,254 (GRCm39) critical splice donor site probably null
R1413:Dmbt1 UTSW 7 130,651,944 (GRCm39) missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 130,646,217 (GRCm39) splice site probably benign
R1463:Dmbt1 UTSW 7 130,711,366 (GRCm39) critical splice donor site probably null
R1509:Dmbt1 UTSW 7 130,676,061 (GRCm39) intron probably benign
R1990:Dmbt1 UTSW 7 130,660,018 (GRCm39) missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 130,708,089 (GRCm39) missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 130,700,863 (GRCm39) missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 130,651,748 (GRCm39) missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 130,703,762 (GRCm39) missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 130,699,305 (GRCm39) missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 130,648,292 (GRCm39) missense probably benign 0.03
R2256:Dmbt1 UTSW 7 130,692,224 (GRCm39) missense probably benign 0.01
R2391:Dmbt1 UTSW 7 130,708,198 (GRCm39) missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 130,696,464 (GRCm39) nonsense probably null
R3014:Dmbt1 UTSW 7 130,633,827 (GRCm39) intron probably benign
R3155:Dmbt1 UTSW 7 130,651,887 (GRCm39) nonsense probably null
R3276:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3442:Dmbt1 UTSW 7 130,707,979 (GRCm39) missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 130,713,819 (GRCm39) missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 130,675,932 (GRCm39) intron probably benign
R4396:Dmbt1 UTSW 7 130,718,361 (GRCm39) missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 130,642,664 (GRCm39) missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 130,651,742 (GRCm39) missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 130,696,472 (GRCm39) missense probably benign 0.01
R5156:Dmbt1 UTSW 7 130,699,400 (GRCm39) critical splice donor site probably null
R5225:Dmbt1 UTSW 7 130,696,465 (GRCm39) missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 130,684,349 (GRCm39) missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 130,642,751 (GRCm39) missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 130,721,240 (GRCm39) missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 130,642,723 (GRCm39) missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 130,665,133 (GRCm39) intron probably benign
R5526:Dmbt1 UTSW 7 130,642,920 (GRCm39) missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 130,701,030 (GRCm39) nonsense probably null
R5566:Dmbt1 UTSW 7 130,708,003 (GRCm39) missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 130,655,797 (GRCm39) missense probably benign 0.17
R6154:Dmbt1 UTSW 7 130,711,370 (GRCm39) splice site probably null
R6188:Dmbt1 UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 130,705,308 (GRCm39) missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 130,718,370 (GRCm39) missense probably benign 0.01
R6603:Dmbt1 UTSW 7 130,648,240 (GRCm39) splice site probably null
R6719:Dmbt1 UTSW 7 130,721,332 (GRCm39) missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 130,648,291 (GRCm39) missense probably benign 0.16
R7148:Dmbt1 UTSW 7 130,668,464 (GRCm39) nonsense probably null
R7191:Dmbt1 UTSW 7 130,646,250 (GRCm39) missense unknown
R7269:Dmbt1 UTSW 7 130,668,351 (GRCm39) missense unknown
R7288:Dmbt1 UTSW 7 130,685,519 (GRCm39) nonsense probably null
R7296:Dmbt1 UTSW 7 130,713,861 (GRCm39) missense unknown
R7349:Dmbt1 UTSW 7 130,642,854 (GRCm39) missense unknown
R7386:Dmbt1 UTSW 7 130,713,965 (GRCm39) missense unknown
R7428:Dmbt1 UTSW 7 130,710,192 (GRCm39) missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 130,681,241 (GRCm39) critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 130,668,192 (GRCm39) missense unknown
R7513:Dmbt1 UTSW 7 130,692,242 (GRCm39) missense unknown
R7553:Dmbt1 UTSW 7 130,706,597 (GRCm39) missense unknown
R7567:Dmbt1 UTSW 7 130,663,093 (GRCm39) splice site probably null
R7584:Dmbt1 UTSW 7 130,690,481 (GRCm39) nonsense probably null
R7736:Dmbt1 UTSW 7 130,718,625 (GRCm39) missense unknown
R7758:Dmbt1 UTSW 7 130,722,926 (GRCm39) missense unknown
R7928:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
R8080:Dmbt1 UTSW 7 130,690,500 (GRCm39) missense unknown
R8098:Dmbt1 UTSW 7 130,710,188 (GRCm39) nonsense probably null
R8125:Dmbt1 UTSW 7 130,700,953 (GRCm39) missense unknown
R8177:Dmbt1 UTSW 7 130,708,162 (GRCm39) missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8366:Dmbt1 UTSW 7 130,668,330 (GRCm39) missense unknown
R8378:Dmbt1 UTSW 7 130,708,195 (GRCm39) missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8400:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8445:Dmbt1 UTSW 7 130,692,110 (GRCm39) missense unknown
R8450:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8511:Dmbt1 UTSW 7 130,703,742 (GRCm39) missense unknown
R8688:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense unknown
R8850:Dmbt1 UTSW 7 130,692,134 (GRCm39) missense unknown
R8852:Dmbt1 UTSW 7 130,642,853 (GRCm39) missense unknown
R8871:Dmbt1 UTSW 7 130,718,597 (GRCm39) missense unknown
R8943:Dmbt1 UTSW 7 130,721,372 (GRCm39) missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 130,639,611 (GRCm39) missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 130,713,798 (GRCm39) missense unknown
R9020:Dmbt1 UTSW 7 130,712,787 (GRCm39) missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 130,718,418 (GRCm39) missense unknown
R9230:Dmbt1 UTSW 7 130,639,642 (GRCm39) missense probably benign 0.01
R9304:Dmbt1 UTSW 7 130,700,855 (GRCm39) missense unknown
R9377:Dmbt1 UTSW 7 130,694,832 (GRCm39) missense unknown
R9428:Dmbt1 UTSW 7 130,668,208 (GRCm39) missense unknown
R9474:Dmbt1 UTSW 7 130,675,987 (GRCm39) missense unknown
R9573:Dmbt1 UTSW 7 130,657,910 (GRCm39) critical splice donor site probably null
R9675:Dmbt1 UTSW 7 130,712,652 (GRCm39) missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 130,660,015 (GRCm39) missense unknown
R9781:Dmbt1 UTSW 7 130,639,599 (GRCm39) missense probably benign 0.00
X0024:Dmbt1 UTSW 7 130,713,977 (GRCm39) nonsense probably null
X0062:Dmbt1 UTSW 7 130,696,581 (GRCm39) missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 130,690,542 (GRCm39) missense unknown
Z1177:Dmbt1 UTSW 7 130,684,215 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACATGAGAGCTCAGTCAGG -3'
(R):5'- TCTTTGCTGATAAGAGTGTCAGTC -3'

Sequencing Primer
(F):5'- GGACACCGCATGATCTCAAGG -3'
(R):5'- AAGAGTGTCAGTCTTTCTAGGGAAC -3'
Posted On 2015-01-23