Incidental Mutation 'R0551:Carm1'
ID45173
Institutional Source Beutler Lab
Gene Symbol Carm1
Ensembl Gene ENSMUSG00000032185
Gene Namecoactivator-associated arginine methyltransferase 1
SynonymsPrmt4
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0551 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21546894-21592623 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 21580491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034703] [ENSMUST00000115394] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032]
Predicted Effect probably null
Transcript: ENSMUST00000034703
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115394
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115394
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115395
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null fetuses are small and die perinatally, whereas heterozygotes are born at the expected Mendelian ratio but show decreased survival through weaning. Mice homozygous for a kinase null allele exhibit neonatal lethality, arrested T cell development, and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Carm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Carm1 APN 9 21587194 missense possibly damaging 0.62
IGL01360:Carm1 APN 9 21587302 missense probably benign 0.19
IGL01401:Carm1 APN 9 21569582 critical splice donor site probably null
IGL02218:Carm1 APN 9 21569512 missense probably damaging 1.00
IGL02436:Carm1 APN 9 21579462 missense probably damaging 1.00
IGL02601:Carm1 APN 9 21586908 missense probably damaging 1.00
R0580:Carm1 UTSW 9 21583584 missense probably damaging 1.00
R0724:Carm1 UTSW 9 21587374 missense probably damaging 1.00
R0883:Carm1 UTSW 9 21569591 splice site probably benign
R1390:Carm1 UTSW 9 21579493 missense probably damaging 1.00
R1713:Carm1 UTSW 9 21586489 missense probably damaging 0.97
R1950:Carm1 UTSW 9 21574516 missense probably benign 0.01
R1960:Carm1 UTSW 9 21580310 missense probably benign 0.40
R2402:Carm1 UTSW 9 21583540 missense probably damaging 1.00
R2512:Carm1 UTSW 9 21575412 critical splice acceptor site probably null
R2520:Carm1 UTSW 9 21583597 splice site probably null
R2939:Carm1 UTSW 9 21579396 splice site probably null
R2940:Carm1 UTSW 9 21579396 splice site probably null
R3081:Carm1 UTSW 9 21579396 splice site probably null
R3407:Carm1 UTSW 9 21586182 missense probably damaging 1.00
R3434:Carm1 UTSW 9 21569473 missense probably damaging 1.00
R3808:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R4504:Carm1 UTSW 9 21569526 missense probably damaging 1.00
R4700:Carm1 UTSW 9 21587184 missense probably benign 0.12
R5019:Carm1 UTSW 9 21579511 critical splice donor site probably null
R5362:Carm1 UTSW 9 21587359 missense probably benign 0.03
R5661:Carm1 UTSW 9 21586999 missense probably benign 0.10
R5730:Carm1 UTSW 9 21580340 missense probably benign 0.37
R5913:Carm1 UTSW 9 21587552 missense probably benign 0.01
R5928:Carm1 UTSW 9 21575302 intron probably benign
R6370:Carm1 UTSW 9 21587519 missense probably benign 0.11
R6431:Carm1 UTSW 9 21583077 missense probably damaging 1.00
R6555:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R7177:Carm1 UTSW 9 21547027 missense unknown
R7235:Carm1 UTSW 9 21587405 critical splice donor site probably benign
R7249:Carm1 UTSW 9 21586209 missense probably benign
R7576:Carm1 UTSW 9 21586536 critical splice donor site probably null
R7650:Carm1 UTSW 9 21580372 missense probably benign 0.00
R7664:Carm1 UTSW 9 21586990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTGCCAGAATTAGGCTCCATCCC -3'
(R):5'- TGCCACATGCTTACTGTGTGTCTAC -3'

Sequencing Primer
(F):5'- TCCTACAGGTCCTGGTGAAGAG -3'
(R):5'- CTACAGTGGGTTTGTCAATGCC -3'
Posted On2013-06-11