Incidental Mutation 'R4117:Pigg'
ID315128
Institutional Source Beutler Lab
Gene Symbol Pigg
Ensembl Gene ENSMUSG00000029263
Gene Namephosphatidylinositol glycan anchor biosynthesis, class G
SynonymsGpi7
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108312609-108349355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108348042 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 982 (R982G)
Ref Sequence ENSEMBL: ENSMUSP00000113818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031189] [ENSMUST00000118910] [ENSMUST00000119014]
Predicted Effect probably benign
Transcript: ENSMUST00000031189
AA Change: R974G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031189
Gene: ENSMUSG00000029263
AA Change: R974G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 68 314 6.3e-15 PFAM
transmembrane domain 428 450 N/A INTRINSIC
transmembrane domain 463 482 N/A INTRINSIC
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 540 562 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 688 705 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
transmembrane domain 785 802 N/A INTRINSIC
transmembrane domain 876 898 N/A INTRINSIC
transmembrane domain 911 933 N/A INTRINSIC
transmembrane domain 948 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118910
AA Change: R849G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112984
Gene: ENSMUSG00000029263
AA Change: R849G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SCOP:d1eqja2 127 202 8e-8 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 338 357 N/A INTRINSIC
transmembrane domain 372 394 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
transmembrane domain 563 580 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 624 641 N/A INTRINSIC
transmembrane domain 660 677 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 786 808 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119014
AA Change: R982G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113818
Gene: ENSMUSG00000029263
AA Change: R982G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 164 286 2.2e-9 PFAM
transmembrane domain 436 458 N/A INTRINSIC
transmembrane domain 471 490 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 548 570 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 793 810 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
transmembrane domain 919 941 N/A INTRINSIC
transmembrane domain 956 975 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in glycosylphosphatidylinositol-anchor biosynthesis. The encoded protein, which is localized to the endoplasmic reticulum, is involved in transferring ethanoloamine phosphate to mannose 2 of glycosylphosphatidylinositol species H7 to form species H8. Allelic variants of this gene have been associated with intellectual disability, hypotonia, and early-onset seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Pigg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Pigg APN 5 108342078 missense probably damaging 1.00
IGL01308:Pigg APN 5 108336477 missense probably damaging 1.00
IGL01485:Pigg APN 5 108336201 missense possibly damaging 0.90
IGL02043:Pigg APN 5 108344324 missense probably damaging 1.00
IGL02104:Pigg APN 5 108342097 missense probably damaging 1.00
IGL02238:Pigg APN 5 108318928 missense possibly damaging 0.64
IGL02311:Pigg APN 5 108336380 missense probably benign
IGL02608:Pigg APN 5 108313003 missense probably damaging 0.98
IGL03338:Pigg APN 5 108319950 missense probably damaging 1.00
P0033:Pigg UTSW 5 108342078 missense probably damaging 1.00
R0082:Pigg UTSW 5 108312885 start gained probably benign
R0449:Pigg UTSW 5 108336411 missense probably benign 0.00
R0616:Pigg UTSW 5 108314085 missense probably damaging 1.00
R1246:Pigg UTSW 5 108341820 missense probably damaging 0.99
R1368:Pigg UTSW 5 108317288 missense probably damaging 1.00
R1777:Pigg UTSW 5 108317391 missense probably damaging 1.00
R1898:Pigg UTSW 5 108336542 missense probably benign
R2022:Pigg UTSW 5 108312922 start gained probably benign
R2037:Pigg UTSW 5 108338652 missense probably damaging 1.00
R2157:Pigg UTSW 5 108318889 missense probably damaging 1.00
R2181:Pigg UTSW 5 108336500 missense probably damaging 0.96
R2291:Pigg UTSW 5 108332917 missense probably damaging 0.97
R3157:Pigg UTSW 5 108314148 missense probably damaging 1.00
R4572:Pigg UTSW 5 108332885 missense probably benign 0.27
R4589:Pigg UTSW 5 108332690 missense probably benign
R5019:Pigg UTSW 5 108332149 missense probably damaging 1.00
R5094:Pigg UTSW 5 108336257 missense possibly damaging 0.90
R5329:Pigg UTSW 5 108314160 missense probably damaging 0.99
R5960:Pigg UTSW 5 108336294 missense probably benign 0.01
R5976:Pigg UTSW 5 108332191 missense probably null 1.00
R6089:Pigg UTSW 5 108341922 missense probably benign
R6797:Pigg UTSW 5 108332828 missense probably damaging 0.99
R6960:Pigg UTSW 5 108326841 missense probably damaging 0.98
R7090:Pigg UTSW 5 108336512 missense possibly damaging 0.92
R7659:Pigg UTSW 5 108338619 missense probably benign 0.03
R7660:Pigg UTSW 5 108338619 missense probably benign 0.03
R7661:Pigg UTSW 5 108338619 missense probably benign 0.03
R7732:Pigg UTSW 5 108318975 missense probably benign 0.00
R7749:Pigg UTSW 5 108336296 missense probably benign
R7765:Pigg UTSW 5 108314054 missense probably benign 0.00
R8021:Pigg UTSW 5 108319939 missense probably damaging 1.00
R8268:Pigg UTSW 5 108338643 missense probably damaging 0.99
R8320:Pigg UTSW 5 108347851 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTGATTTGTTCTGTTCCAG -3'
(R):5'- CCTGGGCTCTCTGAGATAAAC -3'

Sequencing Primer
(F):5'- AGTTGCCACATACATTGTCCTGG -3'
(R):5'- CTGGGCTCTCTGAGATAAACATAATG -3'
Posted On2015-05-14