Incidental Mutation 'R4079:Armc9'
ID316729
Institutional Source Beutler Lab
Gene Symbol Armc9
Ensembl Gene ENSMUSG00000062590
Gene Namearmadillo repeat containing 9
Synonyms5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R4079 (G1)
Quality Score190
Status Validated
Chromosome1
Chromosomal Location86154780-86278284 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 86213129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027434] [ENSMUST00000113309] [ENSMUST00000131412] [ENSMUST00000150059] [ENSMUST00000156675]
Predicted Effect probably benign
Transcript: ENSMUST00000027434
SMART Domains Protein: ENSMUSP00000027434
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 793 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113309
SMART Domains Protein: ENSMUSP00000108934
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 794 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123618
Predicted Effect probably benign
Transcript: ENSMUST00000131412
SMART Domains Protein: ENSMUSP00000117267
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 4e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135973
Predicted Effect probably benign
Transcript: ENSMUST00000150059
SMART Domains Protein: ENSMUSP00000116908
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
SCOP:d1qbkb_ 1 168 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155168
Predicted Effect probably benign
Transcript: ENSMUST00000156675
SMART Domains Protein: ENSMUSP00000119749
Gene: ENSMUSG00000062590

DomainStartEndE-ValueType
SCOP:d1qbkb_ 6 100 3e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Armc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Armc9 APN 1 86198339 missense probably damaging 1.00
IGL00771:Armc9 APN 1 86199835 splice site probably null
IGL01689:Armc9 APN 1 86274418 missense probably benign
IGL02143:Armc9 APN 1 86176865 missense possibly damaging 0.58
IGL02680:Armc9 APN 1 86252278 missense probably damaging 1.00
IGL02812:Armc9 APN 1 86244571 missense probably damaging 0.99
IGL02887:Armc9 APN 1 86164835 missense probably damaging 1.00
IGL03011:Armc9 APN 1 86199916 critical splice donor site probably null
IGL03309:Armc9 APN 1 86274433 missense possibly damaging 0.54
R0184:Armc9 UTSW 1 86198370 missense probably damaging 1.00
R0440:Armc9 UTSW 1 86194262 unclassified probably null
R0787:Armc9 UTSW 1 86202505 missense probably damaging 0.99
R0849:Armc9 UTSW 1 86257270 missense probably benign 0.00
R1687:Armc9 UTSW 1 86156955 start codon destroyed probably null 1.00
R1962:Armc9 UTSW 1 86207974 missense probably damaging 1.00
R2176:Armc9 UTSW 1 86199892 missense probably damaging 1.00
R3418:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R3419:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R4112:Armc9 UTSW 1 86188939 missense possibly damaging 0.80
R4151:Armc9 UTSW 1 86164775 missense probably damaging 1.00
R4675:Armc9 UTSW 1 86202518 missense probably damaging 1.00
R4934:Armc9 UTSW 1 86213079 missense probably damaging 1.00
R4944:Armc9 UTSW 1 86274534 missense probably damaging 0.98
R5069:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5070:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5071:Armc9 UTSW 1 86186116 missense probably benign 0.01
R5238:Armc9 UTSW 1 86199847 missense probably benign 0.01
R5386:Armc9 UTSW 1 86198289 missense probably null 1.00
R5459:Armc9 UTSW 1 86207972 missense probably damaging 0.97
R6027:Armc9 UTSW 1 86244667 missense probably damaging 1.00
R6144:Armc9 UTSW 1 86244579 missense probably benign 0.06
R7111:Armc9 UTSW 1 86159995 missense probably damaging 1.00
R7237:Armc9 UTSW 1 86164849 missense possibly damaging 0.82
R7304:Armc9 UTSW 1 86162715 missense probably benign
R7452:Armc9 UTSW 1 86213092 missense possibly damaging 0.87
R7555:Armc9 UTSW 1 86275678 missense probably damaging 1.00
R7805:Armc9 UTSW 1 86196319 missense probably damaging 1.00
Z1177:Armc9 UTSW 1 86176825 missense not run
Z1177:Armc9 UTSW 1 86196355 missense not run
Predicted Primers PCR Primer
(F):5'- ATGATGCTCACATGAGTGCC -3'
(R):5'- CAATACTGAAGGAGTGGTGTTCTG -3'

Sequencing Primer
(F):5'- TCACATGAGTGCCCCAGCTG -3'
(R):5'- AAGACACCTGGCACCTGGAG -3'
Posted On2015-05-15