Incidental Mutation 'R4079:Rasgrp1'
ID316734
Institutional Source Beutler Lab
Gene Symbol Rasgrp1
Ensembl Gene ENSMUSG00000027347
Gene NameRAS guanyl releasing protein 1
Synonyms
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4079 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location117279993-117343001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117285029 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 693 (S693P)
Ref Sequence ENSEMBL: ENSMUSP00000136423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884]
Predicted Effect probably benign
Transcript: ENSMUST00000102534
AA Change: S693P

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: S693P

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
Pfam:EF-hand_6 474 502 5e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172901
SMART Domains Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.2e-5 PFAM
C1 507 556 5.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173252
SMART Domains Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.1e-5 PFAM
Pfam:C1_1 507 539 3.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173541
AA Change: S658P

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: S658P

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 441 464 1.6e-5 PFAM
Pfam:EF-hand_6 442 467 1.6e-5 PFAM
C1 507 556 5.77e-16 SMART
PDB:4L9U|B 705 756 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174770
SMART Domains Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178884
AA Change: S693P

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: S693P

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Rasgrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Rasgrp1 APN 2 117305791 nonsense probably null
IGL00901:Rasgrp1 APN 2 117285130 missense probably damaging 0.96
IGL01083:Rasgrp1 APN 2 117285068 missense probably benign 0.22
IGL01325:Rasgrp1 APN 2 117298529 missense probably damaging 1.00
IGL01520:Rasgrp1 APN 2 117288663 missense probably damaging 1.00
IGL01776:Rasgrp1 APN 2 117286840 critical splice donor site probably null
IGL01780:Rasgrp1 APN 2 117284878 missense probably benign 0.00
IGL01859:Rasgrp1 APN 2 117289418 missense probably benign 0.00
IGL01892:Rasgrp1 APN 2 117293842 missense probably damaging 1.00
IGL02068:Rasgrp1 APN 2 117300578 splice site probably benign
IGL02684:Rasgrp1 APN 2 117282576 missense probably benign 0.03
grouper UTSW 2 117302004 nonsense probably null
Haddock UTSW 2 117291895 missense probably damaging 0.99
naejangsan UTSW 2 117291792 nonsense probably null
sea_bass UTSW 2 117282654 missense probably benign 0.02
venutian UTSW 2 117284929 nonsense probably null
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0538:Rasgrp1 UTSW 2 117284947 missense probably benign 0.42
R0786:Rasgrp1 UTSW 2 117300499 missense probably benign
R1068:Rasgrp1 UTSW 2 117282576 missense probably benign 0.03
R1165:Rasgrp1 UTSW 2 117284939 missense possibly damaging 0.49
R1491:Rasgrp1 UTSW 2 117282619 nonsense probably null
R1707:Rasgrp1 UTSW 2 117298547 missense probably damaging 1.00
R1869:Rasgrp1 UTSW 2 117290347 missense probably damaging 1.00
R2214:Rasgrp1 UTSW 2 117285165 missense probably damaging 0.98
R2425:Rasgrp1 UTSW 2 117289450 critical splice acceptor site probably null
R3236:Rasgrp1 UTSW 2 117291812 missense probably benign 0.00
R3915:Rasgrp1 UTSW 2 117288641 missense probably damaging 1.00
R4163:Rasgrp1 UTSW 2 117282654 missense probably benign 0.02
R4781:Rasgrp1 UTSW 2 117291709 missense probably benign 0.04
R4782:Rasgrp1 UTSW 2 117284875 missense probably benign 0.00
R5028:Rasgrp1 UTSW 2 117302004 nonsense probably null
R6019:Rasgrp1 UTSW 2 117291895 missense probably damaging 0.99
R6220:Rasgrp1 UTSW 2 117284929 nonsense probably null
R6294:Rasgrp1 UTSW 2 117291792 nonsense probably null
R6335:Rasgrp1 UTSW 2 117293870 missense probably damaging 0.99
R6948:Rasgrp1 UTSW 2 117298604 missense probably damaging 0.99
R7165:Rasgrp1 UTSW 2 117338404 missense probably benign 0.02
R7246:Rasgrp1 UTSW 2 117338354 nonsense probably null
R7372:Rasgrp1 UTSW 2 117285154 missense probably benign 0.01
R7400:Rasgrp1 UTSW 2 117298545 missense probably damaging 1.00
R7432:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117291697 missense possibly damaging 0.78
R7449:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7450:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7475:Rasgrp1 UTSW 2 117286108 missense probably benign
R7487:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7573:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7672:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R8016:Rasgrp1 UTSW 2 117287833
Z1176:Rasgrp1 UTSW 2 117301974
Predicted Primers PCR Primer
(F):5'- TTACTTCAGCAAGAGAACTAAGGG -3'
(R):5'- AGAGATTGTGGACCACAGTG -3'

Sequencing Primer
(F):5'- GGCACCTGTTCCAGTTCTTG -3'
(R):5'- TTGTGGACCACAGTGAGGAG -3'
Posted On2015-05-15