Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Enpp1'

316758

Institutional Source

Beutler Lab

Gene Symbol

Enpp1

Ensembl Gene

ENSMUSG00000037370

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 1

Synonyms

PC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.336) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24637914-24712159 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 24669007 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]

Predicted Effect

probably benign
Transcript: ENSMUST00000039882

SMART Domains

Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

Domain	Start	End	E-Value	Type
low complexity region	22	34	N/A	INTRINSIC
low complexity region	59	69	N/A	INTRINSIC
SO	86	126	2.17e-14	SMART
SO	127	170	1.51e-13	SMART
Pfam:Phosphodiest	194	358	1e-44	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105520

SMART Domains

Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370

Domain	Start	End	E-Value	Type
low complexity region	22	34	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
SO	86	126	2.17e-14	SMART
SO	127	170	1.51e-13	SMART
Pfam:Phosphodiest	194	520	1.8e-87	PFAM
Endonuclease_NS	655	873	5.33e-15	SMART
NUC	656	887	3.62e-107	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000135846

SMART Domains

Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370

Domain	Start	End	E-Value	Type
low complexity region	22	34	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
SO	86	126	2.17e-14	SMART
SO	127	170	1.51e-13	SMART
Pfam:Phosphodiest	194	520	4.2e-91	PFAM
Endonuclease_NS	656	874	5.33e-15	SMART
NUC	657	888	3.62e-107	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150570

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Enpp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Enpp1	APN	10	24645427	missense	possibly damaging	0.93
IGL00966:Enpp1	APN	10	24654031	missense	probably damaging	1.00
IGL01364:Enpp1	APN	10	24664614	missense	probably damaging	1.00
IGL02040:Enpp1	APN	10	24655856	missense	probably damaging	1.00
IGL02143:Enpp1	APN	10	24677974	missense	probably damaging	1.00
IGL02631:Enpp1	APN	10	24641961	missense	probably damaging	1.00
IGL02655:Enpp1	APN	10	24677974	missense	probably damaging	1.00
IGL02677:Enpp1	APN	10	24679185	splice site	probably benign
IGL02691:Enpp1	APN	10	24711892	missense	probably damaging	0.99
IGL02966:Enpp1	APN	10	24660274	missense	probably damaging	1.00
IGL03087:Enpp1	APN	10	24655881	splice site	probably benign
IGL03330:Enpp1	APN	10	24664906	splice site	probably benign
IGL03365:Enpp1	APN	10	24669025	missense	probably damaging	1.00
IGL03377:Enpp1	APN	10	24660283	critical splice acceptor site	probably null
PIT4651001:Enpp1	UTSW	10	24653950	missense	probably benign	0.16
R0011:Enpp1	UTSW	10	24670002	nonsense	probably null
R0201:Enpp1	UTSW	10	24653917	missense	probably benign	0.00
R0496:Enpp1	UTSW	10	24672052	missense	probably benign	0.18
R1228:Enpp1	UTSW	10	24645412	missense	probably benign	0.30
R1536:Enpp1	UTSW	10	24641834	missense	probably benign	0.27
R1927:Enpp1	UTSW	10	24654888	missense	possibly damaging	0.65
R2051:Enpp1	UTSW	10	24711804	critical splice donor site	probably null
R2057:Enpp1	UTSW	10	24660192	missense	probably damaging	0.98
R2353:Enpp1	UTSW	10	24651341	missense	probably benign	0.24
R4077:Enpp1	UTSW	10	24669007	critical splice donor site	probably null
R4739:Enpp1	UTSW	10	24679248	missense	probably null	0.99
R4740:Enpp1	UTSW	10	24679248	missense	probably null	0.99
R4761:Enpp1	UTSW	10	24641951	missense	possibly damaging	0.94
R4822:Enpp1	UTSW	10	24661935	missense	possibly damaging	0.74
R4919:Enpp1	UTSW	10	24648085	missense	probably benign	0.01
R5140:Enpp1	UTSW	10	24652852	missense	possibly damaging	0.51
R5302:Enpp1	UTSW	10	24651390	missense	probably benign
R5421:Enpp1	UTSW	10	24669757	missense	probably damaging	1.00
R5695:Enpp1	UTSW	10	24654908	missense	probably damaging	0.99
R5735:Enpp1	UTSW	10	24654919	missense	possibly damaging	0.92
R5789:Enpp1	UTSW	10	24647239	missense	probably benign
R5942:Enpp1	UTSW	10	24676068	nonsense	probably null
R6048:Enpp1	UTSW	10	24660254	missense	probably damaging	1.00
R6053:Enpp1	UTSW	10	24657126	missense	possibly damaging	0.93
R6305:Enpp1	UTSW	10	24641882	missense	probably damaging	1.00
R6319:Enpp1	UTSW	10	24648031	missense	probably damaging	1.00
R6624:Enpp1	UTSW	10	24669755	nonsense	probably null
R6793:Enpp1	UTSW	10	24655825	missense	probably damaging	1.00
R6936:Enpp1	UTSW	10	24651339	missense	probably benign	0.30
R7255:Enpp1	UTSW	10	24645315	missense	possibly damaging	0.95
R7285:Enpp1	UTSW	10	24660161	missense	probably benign	0.01
R7401:Enpp1	UTSW	10	24645282	missense	probably damaging	1.00
R7429:Enpp1	UTSW	10	24711950	missense	probably benign	0.00
R7430:Enpp1	UTSW	10	24711950	missense	probably benign	0.00
R7526:Enpp1	UTSW	10	24674410	splice site	probably null
R7532:Enpp1	UTSW	10	24675987	missense	probably benign	0.29
R7789:Enpp1	UTSW	10	24654083	splice site	probably null
R8073:Enpp1	UTSW	10	24679244	missense	possibly damaging	0.50
R8283:Enpp1	UTSW	10	24674656	missense	probably benign	0.25
Z1177:Enpp1	UTSW	10	24661942	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGCCCAAAGATCAGAACACAATTTG -3'
(R):5'- CTGTCACTGAAGATGAATGCG -3'

Sequencing Primer
(F):5'- CAGCACCATCTAAGACTCT -3'
(R):5'- CACTGAAGATGAATGCGTTGGTATTG -3'

Posted On

2015-05-15