Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:F13b'

316731

Institutional Source

Beutler Lab

Gene Symbol

F13b

Ensembl Gene

ENSMUSG00000026368

Gene Name

coagulation factor XIII, beta subunit

Synonyms

Cf-13b, Cf13b

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4079 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

139501702-139523752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139501770 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 9 (F9I)

Ref Sequence

ENSEMBL: ENSMUSP00000027615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027615]

Predicted Effect

unknown
Transcript: ENSMUST00000027615
AA Change: F9I

SMART Domains

Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: F9I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CCP	26	88	1.26e-7	SMART
CCP	92	147	2.11e-9	SMART
CCP	154	209	9.83e-10	SMART
CCP	214	268	7.62e-16	SMART
CCP	275	328	8.62e-15	SMART
CCP	337	390	4.62e-15	SMART
CCP	397	451	3.5e-15	SMART
Blast:CCP	455	516	1e-28	BLAST
CCP	525	579	2.44e-14	SMART
Blast:CCP	583	647	1e-8	BLAST

Meta Mutation Damage Score

0.1454

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in F13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:F13b	APN	1	139510587	missense	probably benign	0.01
IGL00937:F13b	APN	1	139517360	splice site	probably benign
IGL01138:F13b	APN	1	139517212	missense	probably damaging	0.99
IGL01319:F13b	APN	1	139506793	missense	probably damaging	0.98
IGL01328:F13b	APN	1	139508082	splice site	probably benign
IGL01621:F13b	APN	1	139503851	missense	probably benign	0.00
IGL01843:F13b	APN	1	139516427	missense	probably damaging	1.00
IGL02153:F13b	APN	1	139516377	missense	probably damaging	1.00
IGL02192:F13b	APN	1	139517333	missense	probably damaging	1.00
IGL02555:F13b	APN	1	139517186	missense	probably damaging	1.00
IGL03036:F13b	APN	1	139508115	missense	possibly damaging	0.80
IGL03185:F13b	APN	1	139516386	missense	probably benign	0.03
IGL03303:F13b	APN	1	139513036	missense	possibly damaging	0.67
IGL03335:F13b	APN	1	139522386	missense	probably damaging	1.00
IGL03371:F13b	APN	1	139506936	missense	probably damaging	1.00
R0139:F13b	UTSW	1	139508203	missense	probably damaging	0.96
R0157:F13b	UTSW	1	139503847	missense	probably benign
R0381:F13b	UTSW	1	139510859	missense	probably damaging	0.98
R0492:F13b	UTSW	1	139522559	splice site	probably null
R0589:F13b	UTSW	1	139506933	missense	possibly damaging	0.94
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1515:F13b	UTSW	1	139510965	missense	probably damaging	1.00
R1869:F13b	UTSW	1	139510934	missense	probably benign	0.44
R2047:F13b	UTSW	1	139508223	missense	probably damaging	1.00
R2218:F13b	UTSW	1	139506844	missense	probably benign	0.42
R2878:F13b	UTSW	1	139501747	start codon destroyed	probably null
R3032:F13b	UTSW	1	139517333	missense	probably damaging	1.00
R4077:F13b	UTSW	1	139501770	missense	unknown
R4208:F13b	UTSW	1	139516341	missense	probably damaging	1.00
R4350:F13b	UTSW	1	139516298	missense	probably benign	0.00
R4674:F13b	UTSW	1	139501804	missense	unknown
R4675:F13b	UTSW	1	139501804	missense	unknown
R4972:F13b	UTSW	1	139510923	missense	probably damaging	1.00
R5212:F13b	UTSW	1	139512987	missense	probably benign
R5343:F13b	UTSW	1	139510544	missense	possibly damaging	0.61
R5503:F13b	UTSW	1	139522543	missense	probably benign	0.00
R5984:F13b	UTSW	1	139508212	missense	probably damaging	1.00
R7012:F13b	UTSW	1	139516358	missense	probably benign
R7155:F13b	UTSW	1	139508157	missense	probably damaging	1.00
R7250:F13b	UTSW	1	139516489	critical splice donor site	probably null
R7478:F13b	UTSW	1	139507695	missense	probably benign	0.01
R7779:F13b	UTSW	1	139516386	missense	probably benign	0.03
R7960:F13b	UTSW	1	139503771	nonsense	probably null
R8007:F13b	UTSW	1	139506942	missense	probably benign	0.11
R8043:F13b	UTSW	1	139522448	missense	probably benign
R8281:F13b	UTSW	1	139510951	missense	probably benign	0.03
Z1088:F13b	UTSW	1	139508202	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- GAAATATACCCTTCCGTATTTGGC -3'
(R):5'- TGCATTACAAAACTGGCATGTG -3'

Sequencing Primer
(F):5'- GGCCTGTATTCATTATTTATGCTGC -3'
(R):5'- CATTACAAAACTGGCATGTGAAAGTG -3'

Posted On

2015-05-15