Mutagenetix > Incidental Mutation

Incidental Mutation 'R4111:Sbf2'

317308

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R4111 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 110428242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 470 (P470S)

Ref Sequence

ENSEMBL: ENSMUSP00000126217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]

AlphaFold

E9PXF8

Predicted Effect

probably benign
Transcript: ENSMUST00000033058
AA Change: P516S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: P516S

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163579

Predicted Effect

unknown
Transcript: ENSMUST00000164559
AA Change: P123S

SMART Domains

Protein: ENSMUSP00000128265
Gene: ENSMUSG00000038371
AA Change: P123S

Domain	Start	End	E-Value	Type
dDENN	2	74	3.04e-2	SMART
Pfam:SBF2	138	177	1.6e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164759
AA Change: P516S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: P516S

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165449

Predicted Effect

probably damaging
Transcript: ENSMUST00000166020
AA Change: P470S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: P470S

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167880

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171378

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot10	A	T	15: 20,666,526	L43Q	probably damaging	Het
Alms1	G	A	6: 85,620,888	V1368I	probably benign	Het
Ambra1	T	C	2: 91,900,558	S894P	probably damaging	Het
Arhgef12	C	A	9: 42,972,274	G1320C	probably damaging	Het
Atg7	G	C	6: 114,713,294	G596R	probably damaging	Het
AY761184	T	C	8: 21,702,663	T106A	possibly damaging	Het
Birc6	T	C	17: 74,566,015	V423A	probably damaging	Het
Cdh17	T	C	4: 11,814,628	S728P	probably damaging	Het
Ctu2	G	A	8: 122,476,517	R24Q	possibly damaging	Het
Dclk3	T	C	9: 111,469,080	I564T	probably damaging	Het
Ddx39b	T	A	17: 35,243,364	I42N	possibly damaging	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dzip1	T	A	14: 118,877,233	K837*	probably null	Het
Epha1	G	A	6: 42,358,838	T955M	possibly damaging	Het
Etfbkmt	T	C	6: 149,144,591		probably benign	Het
Etfrf1	T	C	6: 145,215,372	Y23H	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gm12355	A	T	11: 98,625,397	V50D	probably damaging	Het
Gm5611	T	A	9: 17,030,693		noncoding transcript	Het
Gpr37l1	T	C	1: 135,167,270	T79A	possibly damaging	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Hyls1	T	A	9: 35,561,418	Y234F	probably damaging	Het
Ifnar1	C	A	16: 91,496,158	P230T	probably damaging	Het
Impact	T	C	18: 12,976,033		probably null	Het
Kcna6	G	C	6: 126,739,774	R51G	probably damaging	Het
Lrpprc	G	A	17: 84,726,338	T1037M	probably benign	Het
Olfr1239	C	A	2: 89,418,100	L104F	probably benign	Het
Olfr1440	T	C	19: 12,394,301	F13L	probably damaging	Het
Olfr430	T	A	1: 174,069,433	I45N	probably damaging	Het
Olfr979	C	A	9: 40,000,898	E110*	probably null	Het
Pask	A	G	1: 93,310,818	V1315A	probably damaging	Het
Pramef25	T	A	4: 143,949,905	I210F	possibly damaging	Het
Prl7a2	A	T	13: 27,665,067	Y80N	possibly damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Rtn2	T	C	7: 19,286,844	S81P	probably damaging	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Sox30	A	G	11: 46,017,214	Y736C	probably benign	Het
Synj2	G	A	17: 6,007,965	G243S	probably benign	Het
Tbr1	C	T	2: 61,811,732	P184L	probably benign	Het
Tns1	T	C	1: 73,941,932	N1091S	probably damaging	Het
Trappc10	A	G	10: 78,196,430	F1008S	probably benign	Het
Ube4a	T	A	9: 44,948,949	I272F	probably damaging	Het
Uhrf1bp1	T	A	17: 27,886,090	L586*	probably null	Het
Vmn1r122	A	T	7: 21,133,513	S206T	probably damaging	Het
Vmn2r1	A	C	3: 64,089,755	K277N	probably benign	Het
Vps13a	T	C	19: 16,640,628	E2931G	probably damaging	Het
Wdr70	G	T	15: 7,976,991	Q360K	probably benign	Het
Wdr90	G	T	17: 25,849,368	Q1329K	possibly damaging	Het
Wrn	T	C	8: 33,352,155	N37S	probably benign	Het
Yap1	A	T	9: 7,938,431	*358K	probably null	Het
Zfp964	T	A	8: 69,664,104	S450R	probably benign	Het
Zkscan2	T	C	7: 123,482,684		probably benign	Het
Zmynd10	A	T	9: 107,549,052	K133*	probably null	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
R8773:Sbf2	UTSW	7	110348995	missense	probably benign
R8786:Sbf2	UTSW	7	110464586	critical splice donor site	probably null
R8812:Sbf2	UTSW	7	110329862	missense	probably damaging	1.00
R8876:Sbf2	UTSW	7	110449939	missense	probably damaging	0.99
R8932:Sbf2	UTSW	7	110440948	critical splice donor site	probably null
R8954:Sbf2	UTSW	7	110438911	nonsense	probably null
R8991:Sbf2	UTSW	7	110312689	missense	probably benign	0.20
R9119:Sbf2	UTSW	7	110312085	missense	possibly damaging	0.93
R9310:Sbf2	UTSW	7	110315085	missense	possibly damaging	0.58
R9344:Sbf2	UTSW	7	110341328	missense	probably benign	0.10
R9346:Sbf2	UTSW	7	110320739	missense	probably benign	0.05
R9404:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9406:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9408:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9472:Sbf2	UTSW	7	110371591	missense	possibly damaging	0.88
R9554:Sbf2	UTSW	7	110441464	missense	probably damaging	1.00
R9562:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9624:Sbf2	UTSW	7	110364650	missense	probably damaging	1.00
R9652:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9653:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9709:Sbf2	UTSW	7	110428307	missense	probably damaging	0.99
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCTTGTATTTCATTAGGACACACAG -3'
(R):5'- ACACCTGTTTGATTTTAGTGTGTCC -3'

Sequencing Primer
(F):5'- CTAGGTAGCTCAGTCTGGCCTAAAG -3'
(R):5'- GATTTTAGTGTGTCCCTCTGTGCTC -3'

Posted On

2015-05-15