Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Exoc5'

322291

Institutional Source

Beutler Lab

Gene Symbol

Exoc5

Ensembl Gene

ENSMUSG00000061244

Gene Name

exocyst complex component 5

Synonyms

Sec10l1, SEC10, PRO1912

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49004090-49066653 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 49015480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 625 (C625*)

Ref Sequence

ENSEMBL: ENSMUSP00000125434 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161504] [ENSMUST00000162175]

AlphaFold

Q3TPX4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159651

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160453

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160833

Predicted Effect

probably null
Transcript: ENSMUST00000161504
AA Change: C560*

SMART Domains

Protein: ENSMUSP00000124012
Gene: ENSMUSG00000061244
AA Change: C560*

Domain	Start	End	E-Value	Type
Pfam:Sec10	43	175	9.5e-24	PFAM
Pfam:Sec10	175	642	1.1e-119	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000162175
AA Change: C625*

SMART Domains

Protein: ENSMUSP00000125434
Gene: ENSMUSG00000061244
AA Change: C625*

Domain	Start	End	E-Value	Type
Pfam:Sec10	89	707	6.6e-154	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells die prior to E8.5. Mice homozygous for a conditional allele activated in kidney cells exhibit ureteropelvic junction obstructions leading to neontal death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Exoc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01010:Exoc5	APN	14	49037755	missense	probably damaging	1.00
IGL01473:Exoc5	APN	14	49014294	missense	possibly damaging	0.83
IGL01599:Exoc5	APN	14	49034964	missense	probably benign	0.00
IGL01702:Exoc5	APN	14	49015615	nonsense	probably null
IGL02173:Exoc5	APN	14	49034801	splice site	probably benign
IGL02211:Exoc5	APN	14	49014210	missense	probably damaging	1.00
IGL02874:Exoc5	APN	14	49051446	missense	probably benign	0.02
IGL02968:Exoc5	APN	14	49033269	critical splice donor site	probably null
IGL03167:Exoc5	APN	14	49051345	missense	probably damaging	1.00
IGL03207:Exoc5	APN	14	49033375	missense	probably benign
PIT4260001:Exoc5	UTSW	14	49048765	missense	probably benign	0.01
R0139:Exoc5	UTSW	14	49036036	missense	probably damaging	1.00
R0594:Exoc5	UTSW	14	49036087	splice site	probably benign
R0945:Exoc5	UTSW	14	49039342	splice site	probably benign
R1968:Exoc5	UTSW	14	49034890	missense	probably benign	0.27
R2082:Exoc5	UTSW	14	49015587	missense	probably benign	0.07
R2186:Exoc5	UTSW	14	49015479	missense	probably benign	0.08
R2356:Exoc5	UTSW	14	49016281	missense	probably benign	0.00
R3419:Exoc5	UTSW	14	49023278	missense	probably damaging	1.00
R3743:Exoc5	UTSW	14	49014349	missense	probably benign	0.00
R3743:Exoc5	UTSW	14	49033407	nonsense	probably null
R3870:Exoc5	UTSW	14	49019396	splice site	probably benign
R4794:Exoc5	UTSW	14	49048900	critical splice acceptor site	probably null
R4853:Exoc5	UTSW	14	49052369	small deletion	probably benign
R4864:Exoc5	UTSW	14	49052382	missense	probably benign	0.00
R4883:Exoc5	UTSW	14	49052364	missense	probably damaging	1.00
R5098:Exoc5	UTSW	14	49048847	missense	possibly damaging	0.90
R5965:Exoc5	UTSW	14	49034931	missense	probably damaging	1.00
R6036:Exoc5	UTSW	14	49014322	missense	possibly damaging	0.82
R6036:Exoc5	UTSW	14	49014322	missense	possibly damaging	0.82
R6820:Exoc5	UTSW	14	49048930	splice site	probably null
R8473:Exoc5	UTSW	14	49019403	missense	probably null	0.98
R8987:Exoc5	UTSW	14	49015529	missense	probably damaging	1.00
R9229:Exoc5	UTSW	14	49014253	nonsense	probably null
R9250:Exoc5	UTSW	14	49019458	missense	probably damaging	1.00
R9340:Exoc5	UTSW	14	49048840	missense	probably damaging	0.98
R9381:Exoc5	UTSW	14	49037737	missense	probably benign
R9729:Exoc5	UTSW	14	49015629	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCTCTTAATGCTGCCAGC -3'
(R):5'- CATTCTTGTACACGCATTAGTGC -3'

Sequencing Primer
(F):5'- GCGAAATCACACATTTCCAGTACAGG -3'
(R):5'- TTGCTGGGAATGAGCTACACCAC -3'

Posted On

2015-06-20