Incidental Mutation 'R4298:Pdcd4'
ID323450
Institutional Source Beutler Lab
Gene Symbol Pdcd4
Ensembl Gene ENSMUSG00000024975
Gene Nameprogrammed cell death 4
SynonymsMA-3, D19Ucla1, TIS
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53892231-53929861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53919661 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 201 (P201Q)
Ref Sequence ENSEMBL: ENSMUSP00000133135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025931] [ENSMUST00000074371] [ENSMUST00000165617]
Predicted Effect probably damaging
Transcript: ENSMUST00000025931
AA Change: P201Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025931
Gene: ENSMUSG00000024975
AA Change: P201Q

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074371
AA Change: P201Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073975
Gene: ENSMUSG00000024975
AA Change: P201Q

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165617
AA Change: P201Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133135
Gene: ENSMUSG00000024975
AA Change: P201Q

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Meta Mutation Damage Score 0.2937 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a tumor suppressor and encodes a protein that binds to the eukaryotic translation initiation factor 4A1 and inhibits its function by preventing RNA binding. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null allele have a higher prevalence of B cell derived lymphomas, multi-organ cysts and decreased susceptibility to experimentally induced autoimmune encephalomyelitis and type 1 diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Pdcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Pdcd4 APN 19 53929121 missense probably benign
IGL02608:Pdcd4 APN 19 53927207 splice site probably null
seventh UTSW 19 53922133 critical splice donor site probably null
Uccidere UTSW 19 53910948 missense probably damaging 1.00
R0893:Pdcd4 UTSW 19 53929094 missense probably damaging 1.00
R1437:Pdcd4 UTSW 19 53909243 missense probably damaging 0.99
R1836:Pdcd4 UTSW 19 53926219 missense probably damaging 1.00
R6365:Pdcd4 UTSW 19 53922133 critical splice donor site probably null
R6436:Pdcd4 UTSW 19 53926931 splice site probably null
R7523:Pdcd4 UTSW 19 53910948 missense probably damaging 1.00
R8244:Pdcd4 UTSW 19 53907534 missense probably benign
R8739:Pdcd4 UTSW 19 53910974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACTGTTGGCAATGTTCTTCC -3'
(R):5'- AAGACACAAACCTGCGGTG -3'

Sequencing Primer
(F):5'- GCAGGTAGAGCTTATATCACTGC -3'
(R):5'- TGCCCTAGGAGTGTCCAAG -3'
Posted On2015-06-20