Incidental Mutation 'R4298:Taf1d'
ID323431
Institutional Source Beutler Lab
Gene Symbol Taf1d
Ensembl Gene ENSMUSG00000031939
Gene NameTATA-box binding protein associated factor, RNA polymerase I, D
SynonymsTAF(I)41, TAFI41, 4930553M18Rik, Josd3
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15306214-15316991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15308643 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 63 (S63P)
Ref Sequence ENSEMBL: ENSMUSP00000149377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034415] [ENSMUST00000164079] [ENSMUST00000178977] [ENSMUST00000180339] [ENSMUST00000213763] [ENSMUST00000214054] [ENSMUST00000215124] [ENSMUST00000216109] [ENSMUST00000216825] [ENSMUST00000216955]
Predicted Effect probably damaging
Transcript: ENSMUST00000034415
AA Change: S63P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034415
Gene: ENSMUSG00000031939
AA Change: S63P

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 4.3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104426
Predicted Effect probably damaging
Transcript: ENSMUST00000164079
AA Change: S63P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129141
Gene: ENSMUSG00000031939
AA Change: S63P

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 5.4e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178977
SMART Domains Protein: ENSMUSP00000136335
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180339
SMART Domains Protein: ENSMUSP00000136717
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213317
Predicted Effect probably damaging
Transcript: ENSMUST00000213763
AA Change: S63P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213923
Predicted Effect probably damaging
Transcript: ENSMUST00000214054
AA Change: S63P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214221
Predicted Effect probably benign
Transcript: ENSMUST00000214316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214899
Predicted Effect possibly damaging
Transcript: ENSMUST00000215124
AA Change: S63P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215741
Predicted Effect probably benign
Transcript: ENSMUST00000215749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216073
Predicted Effect probably damaging
Transcript: ENSMUST00000216109
AA Change: S63P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216768
Predicted Effect probably damaging
Transcript: ENSMUST00000216825
AA Change: S63P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216955
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAF1D is a member of the SL1 complex, which includes TBP (MIM 600075) and TAF1A (MIM 604903), TAF1B (MIM 604904), and TAF1C (MIM 604905), and plays a role in RNA polymerase I transcription (Wang et al., 2004 [PubMed 15520167]; Gorski et al., 2007 [PubMed 17318177]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dsc3 A T 18: 19,980,754 N370K possibly damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Taf1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Taf1d APN 9 15311603 missense probably damaging 0.99
IGL01861:Taf1d APN 9 15308739 unclassified probably null
IGL02448:Taf1d APN 9 15310394 nonsense probably null
IGL03106:Taf1d APN 9 15309941 missense possibly damaging 0.83
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R0079:Taf1d UTSW 9 15309944 missense probably benign 0.08
R4379:Taf1d UTSW 9 15311981 intron probably benign
R4381:Taf1d UTSW 9 15311981 intron probably benign
R4927:Taf1d UTSW 9 15309954 missense probably damaging 0.99
R5541:Taf1d UTSW 9 15308850 missense probably damaging 0.99
R6072:Taf1d UTSW 9 15311560 missense probably benign 0.00
R6736:Taf1d UTSW 9 15307823 critical splice donor site probably null
R7527:Taf1d UTSW 9 15308837 missense possibly damaging 0.94
X0057:Taf1d UTSW 9 15308520 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGTTGGAGCTGTGAACTGAAG -3'
(R):5'- GCATCTATTTGCGACCTTCTAG -3'

Sequencing Primer
(F):5'- AGCATGGCCTTGAAACTCG -3'
(R):5'- AGTGATCCTCGTTCCCGATGG -3'
Posted On2015-06-20