Incidental Mutation 'R4298:Dsc3'
ID323448
Institutional Source Beutler Lab
Gene Symbol Dsc3
Ensembl Gene ENSMUSG00000059898
Gene Namedesmocollin 3
Synonyms
MMRRC Submission 041086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4298 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location19960930-20002351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19980754 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 370 (N370K)
Ref Sequence ENSEMBL: ENSMUSP00000153261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115848
AA Change: N370K

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: N370K

DomainStartEndE-ValueType
Cadherin_pro 31 113 9.08e-41 SMART
CA 156 241 4.99e-11 SMART
CA 265 353 7.79e-22 SMART
CA 376 471 2.66e-6 SMART
CA 494 576 4.58e-19 SMART
CA 595 677 3.02e-2 SMART
transmembrane domain 692 714 N/A INTRINSIC
Pfam:Cadherin_C 778 895 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000225110
AA Change: N370K

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1832 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,531,525 probably null Het
Ccser2 T A 14: 36,890,380 Q158L possibly damaging Het
Cct7 T A 6: 85,468,173 C469S probably damaging Het
Chmp7 A T 14: 69,719,201 probably null Het
Clcn4 C T 7: 7,296,738 D31N possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctdp1 A T 18: 80,449,957 V441E probably benign Het
Cyp4a10 T C 4: 115,532,692 L498P probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Ebf3 C T 7: 137,225,229 R318Q possibly damaging Het
Epcam T C 17: 87,640,534 probably null Het
Erich6 G T 3: 58,624,291 A428D probably benign Het
Ext1 A T 15: 53,345,125 I80N probably benign Het
Extl1 T C 4: 134,357,658 E667G probably damaging Het
F2 T G 2: 91,629,320 probably null Het
Fbxw16 T C 9: 109,446,557 I135V probably benign Het
Glipr1l1 A T 10: 112,062,347 D119V probably benign Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Lmbrd2 G A 15: 9,165,795 R252H possibly damaging Het
Lyst A G 13: 13,634,887 T381A probably damaging Het
Mcpt4 A T 14: 56,060,987 V97D possibly damaging Het
Nefh A G 11: 4,940,066 I851T probably benign Het
Nf1 A T 11: 79,384,244 I44F probably damaging Het
Nyap2 A T 1: 81,241,096 I278F probably damaging Het
Olfr1263 A T 2: 90,015,649 T240S probably benign Het
Olfr268-ps1 G T 2: 111,844,444 noncoding transcript Het
Pdcd4 C A 19: 53,919,661 P201Q probably damaging Het
Pramef25 A T 4: 143,949,143 L371* probably null Het
Prdm11 T C 2: 92,993,383 T179A probably benign Het
Qrfpr T A 3: 36,189,554 I133F probably damaging Het
Rack1 T C 11: 48,801,626 probably benign Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sag G C 1: 87,845,015 D402H probably benign Het
Sbk3 T A 7: 4,969,980 T64S probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3gl1 C T 17: 56,019,173 G111D probably damaging Het
Spata20 G A 11: 94,483,088 R379W probably damaging Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stk39 C T 2: 68,390,940 G213D probably damaging Het
Szt2 A G 4: 118,365,406 probably benign Het
Taf1d T C 9: 15,308,643 S63P probably damaging Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Ttn G T 2: 76,724,050 A30807D probably damaging Het
Unc119 A G 11: 78,348,122 N158S probably damaging Het
Vmn2r116 T A 17: 23,401,827 I845N possibly damaging Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Zdhhc4 A G 5: 143,324,242 V87A probably damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in Dsc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dsc3 APN 18 19985631 missense probably null 1.00
IGL01978:Dsc3 APN 18 19974196 missense possibly damaging 0.79
IGL02101:Dsc3 APN 18 20001906 missense probably benign 0.01
IGL02165:Dsc3 APN 18 19983652 missense probably benign 0.06
IGL02543:Dsc3 APN 18 19965828 missense probably benign 0.11
IGL02970:Dsc3 APN 18 19968260 missense probably damaging 1.00
IGL03097:Dsc3 UTSW 18 19974048 missense probably benign 0.30
R0133:Dsc3 UTSW 18 19971582 missense probably damaging 0.96
R0304:Dsc3 UTSW 18 19981241 missense probably damaging 1.00
R0360:Dsc3 UTSW 18 19971582 missense possibly damaging 0.79
R0673:Dsc3 UTSW 18 19989590 missense probably damaging 1.00
R0826:Dsc3 UTSW 18 19981172 missense probably damaging 0.99
R1120:Dsc3 UTSW 18 19986977 missense probably benign 0.05
R1491:Dsc3 UTSW 18 19987034 missense probably damaging 0.99
R1667:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R1688:Dsc3 UTSW 18 19966227 missense probably damaging 1.00
R1792:Dsc3 UTSW 18 19986998 missense probably damaging 1.00
R1858:Dsc3 UTSW 18 19965716 missense probably damaging 0.97
R1965:Dsc3 UTSW 18 19980672 missense probably damaging 1.00
R1988:Dsc3 UTSW 18 19965846 missense possibly damaging 0.86
R2049:Dsc3 UTSW 18 19989680 missense possibly damaging 0.65
R2127:Dsc3 UTSW 18 19968354 missense probably benign 0.00
R2143:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2144:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2148:Dsc3 UTSW 18 19965638 missense probably damaging 0.99
R3038:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R3872:Dsc3 UTSW 18 19971508 missense probably damaging 0.99
R4229:Dsc3 UTSW 18 19965821 missense probably damaging 1.00
R4491:Dsc3 UTSW 18 20001865 missense probably benign 0.30
R4590:Dsc3 UTSW 18 19989695 missense probably damaging 1.00
R4615:Dsc3 UTSW 18 19971488 missense possibly damaging 0.67
R5316:Dsc3 UTSW 18 19963541 missense possibly damaging 0.67
R5758:Dsc3 UTSW 18 19989534 missense probably damaging 1.00
R5796:Dsc3 UTSW 18 19971501 missense probably benign 0.01
R5916:Dsc3 UTSW 18 19987020 missense probably damaging 1.00
R6022:Dsc3 UTSW 18 19966338 missense probably damaging 0.97
R6233:Dsc3 UTSW 18 19965795 missense possibly damaging 0.77
R6351:Dsc3 UTSW 18 19966291 missense probably benign 0.05
R6971:Dsc3 UTSW 18 19966218 critical splice donor site probably null
R7261:Dsc3 UTSW 18 19980757 nonsense probably null
R7442:Dsc3 UTSW 18 19981156 missense probably damaging 1.00
R7795:Dsc3 UTSW 18 19966231 missense probably damaging 1.00
R8051:Dsc3 UTSW 18 19981213 missense probably damaging 1.00
R8531:Dsc3 UTSW 18 19968392 missense probably benign
R8531:Dsc3 UTSW 18 19981217 missense probably damaging 1.00
X0061:Dsc3 UTSW 18 19989627 missense probably damaging 1.00
Z1177:Dsc3 UTSW 18 19966315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCACCGAGCTGATAAAAC -3'
(R):5'- AAGGTATTGCCATCCTTTGAGG -3'

Sequencing Primer
(F):5'- TGACATACAGTTCTCACTCGTC -3'
(R):5'- GCCATCCTTTGAGGCATGTGC -3'
Posted On2015-06-20