Mutagenetix > Incidental Mutations

Incidental Mutation 'R4581:Actc1'

343646

Institutional Source

Beutler Lab

Gene Symbol

Actc1

Ensembl Gene

ENSMUSG00000068614

Gene Name

actin, alpha, cardiac muscle 1

Synonyms

alphac-actin, Actc-1

MMRRC Submission

041802-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114047282-114053548 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 114049608 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 175 (H175N)

Ref Sequence

ENSEMBL: ENSMUSP00000087736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090269] [ENSMUST00000149125]

AlphaFold

P68033

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090269
AA Change: H175N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000087736
Gene: ENSMUSG00000068614
AA Change: H175N

Domain	Start	End	E-Value	Type
ACTIN	7	377	4.38e-238	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131299

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140041

Predicted Effect

probably benign
Transcript: ENSMUST00000149125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154140

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to four others. The protein encoded by this gene belongs to the actin family which is comprised of three main groups of actin isoforms, alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. Defects in this gene have been associated with idiopathic dilated cardiomyopathy (IDC) and familial hypertrophic cardiomyopathy (FHC). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic and postnatal lethality. Animals that survive to birth die within the first 2 weeks and display reduced body size and heart muscle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Adgrd1	C	T	5: 129,202,531	A863V	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Arhgef4	G	A	1: 34,732,124	E1171K	possibly damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Ddx60	A	T	8: 62,023,261	M1548L	possibly damaging	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Ltn1	A	T	16: 87,402,024		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Osmr	C	T	15: 6,842,894	V240I	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Taf6l	T	C	19: 8,778,208	D261G	probably damaging	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc11	A	T	8: 47,493,345	M1084K	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Actc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Actc1	APN	2	114048113	unclassified	probably benign
IGL02985:Actc1	APN	2	114048160	missense	probably damaging	1.00
IGL03204:Actc1	APN	2	114049530	missense	possibly damaging	0.57
R1201:Actc1	UTSW	2	114049513	critical splice donor site	probably null
R1463:Actc1	UTSW	2	114049529	missense	probably damaging	1.00
R4255:Actc1	UTSW	2	114049216	missense	probably benign	0.02
R4476:Actc1	UTSW	2	114049226	missense	probably benign
R5466:Actc1	UTSW	2	114050498	missense	probably damaging	0.99
R6395:Actc1	UTSW	2	114049250	nonsense	probably null
R7915:Actc1	UTSW	2	114050486	missense	probably damaging	1.00
R8927:Actc1	UTSW	2	114050400	nonsense	probably null
R8928:Actc1	UTSW	2	114050400	nonsense	probably null
R9128:Actc1	UTSW	2	114050465	missense	possibly damaging	0.60
R9182:Actc1	UTSW	2	114052013	missense	probably benign
R9188:Actc1	UTSW	2	114050498	missense	probably damaging	0.99
R9224:Actc1	UTSW	2	114049229	frame shift	probably null
R9274:Actc1	UTSW	2	114049271	missense	probably benign
Z1176:Actc1	UTSW	2	114051997	missense	probably benign	0.00
Z1177:Actc1	UTSW	2	114047513	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAGGGCTTCATAGTCAAGC -3'
(R):5'- GGGATTTGATTGTTTCCCATACC -3'

Sequencing Primer
(F):5'- ATATGGGGAAGTAGGTCTATCTACC -3'
(R):5'- TGGTTCGAAGTGCTTCAC -3'

Posted On

2015-09-24