Incidental Mutation 'R4581:Actc1'
ID 343646
Institutional Source Beutler Lab
Gene Symbol Actc1
Ensembl Gene ENSMUSG00000068614
Gene Name actin, alpha, cardiac muscle 1
Synonyms alphac-actin, Actc-1
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 114047282-114053548 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114049608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 175 (H175N)
Ref Sequence ENSEMBL: ENSMUSP00000087736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090269] [ENSMUST00000149125]
AlphaFold P68033
Predicted Effect possibly damaging
Transcript: ENSMUST00000090269
AA Change: H175N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087736
Gene: ENSMUSG00000068614
AA Change: H175N

DomainStartEndE-ValueType
ACTIN 7 377 4.38e-238 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140041
Predicted Effect probably benign
Transcript: ENSMUST00000149125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154140
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to four others. The protein encoded by this gene belongs to the actin family which is comprised of three main groups of actin isoforms, alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. Defects in this gene have been associated with idiopathic dilated cardiomyopathy (IDC) and familial hypertrophic cardiomyopathy (FHC). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic and postnatal lethality. Animals that survive to birth die within the first 2 weeks and display reduced body size and heart muscle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Actc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Actc1 APN 2 114048113 unclassified probably benign
IGL02985:Actc1 APN 2 114048160 missense probably damaging 1.00
IGL03204:Actc1 APN 2 114049530 missense possibly damaging 0.57
R1201:Actc1 UTSW 2 114049513 critical splice donor site probably null
R1463:Actc1 UTSW 2 114049529 missense probably damaging 1.00
R4255:Actc1 UTSW 2 114049216 missense probably benign 0.02
R4476:Actc1 UTSW 2 114049226 missense probably benign
R5466:Actc1 UTSW 2 114050498 missense probably damaging 0.99
R6395:Actc1 UTSW 2 114049250 nonsense probably null
R7915:Actc1 UTSW 2 114050486 missense probably damaging 1.00
R8927:Actc1 UTSW 2 114050400 nonsense probably null
R8928:Actc1 UTSW 2 114050400 nonsense probably null
R9128:Actc1 UTSW 2 114050465 missense possibly damaging 0.60
R9182:Actc1 UTSW 2 114052013 missense probably benign
R9188:Actc1 UTSW 2 114050498 missense probably damaging 0.99
R9224:Actc1 UTSW 2 114049229 frame shift probably null
R9274:Actc1 UTSW 2 114049271 missense probably benign
Z1176:Actc1 UTSW 2 114051997 missense probably benign 0.00
Z1177:Actc1 UTSW 2 114047513 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGGGCTTCATAGTCAAGC -3'
(R):5'- GGGATTTGATTGTTTCCCATACC -3'

Sequencing Primer
(F):5'- ATATGGGGAAGTAGGTCTATCTACC -3'
(R):5'- TGGTTCGAAGTGCTTCAC -3'
Posted On 2015-09-24