Incidental Mutation 'R4697:Txndc11'
ID 355799
Institutional Source Beutler Lab
Gene Symbol Txndc11
Ensembl Gene ENSMUSG00000022498
Gene Name thioredoxin domain containing 11
Synonyms 2810408E11Rik, EF-hand binding protein 1, EFP1, Txdc11
MMRRC Submission 041947-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 10892775-10952514 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10902178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 679 (V679I)
Ref Sequence ENSEMBL: ENSMUSP00000041113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038424] [ENSMUST00000118362] [ENSMUST00000145225]
AlphaFold Q8K2W3
Predicted Effect probably damaging
Transcript: ENSMUST00000038424
AA Change: V679I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041113
Gene: ENSMUSG00000022498
AA Change: V679I

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.8e-11 PFAM
Pfam:Thioredoxin 660 756 1e-11 PFAM
coiled coil region 793 830 N/A INTRINSIC
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118362
SMART Domains Protein: ENSMUSP00000113432
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 2.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131012
Predicted Effect probably benign
Transcript: ENSMUST00000145225
SMART Domains Protein: ENSMUSP00000116563
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148183
Meta Mutation Damage Score 0.6015 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,243 (GRCm39) M1T probably null Het
Aatf T A 11: 84,339,964 (GRCm39) D449V probably damaging Het
Acbd3 T A 1: 180,549,509 (GRCm39) probably benign Het
Bicc1 T A 10: 70,789,314 (GRCm39) I366F possibly damaging Het
Ccdc74a T C 16: 17,467,613 (GRCm39) S184P possibly damaging Het
Cntn4 T C 6: 106,502,446 (GRCm39) V401A probably damaging Het
Cux2 T C 5: 122,011,816 (GRCm39) T540A probably damaging Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dpp7 A G 2: 25,244,931 (GRCm39) Y209H probably benign Het
Dstyk T A 1: 132,377,225 (GRCm39) F277Y probably damaging Het
Dtx1 A T 5: 120,832,473 (GRCm39) probably null Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Ednra T C 8: 78,391,624 (GRCm39) H422R probably benign Het
Erlec1 T A 11: 30,902,640 (GRCm39) I67F probably benign Het
Fam161b G A 12: 84,395,332 (GRCm39) probably benign Het
Gata5 A T 2: 179,969,172 (GRCm39) C345* probably null Het
Glmp T C 3: 88,235,581 (GRCm39) V47A probably damaging Het
Gm9762 T A 3: 78,873,857 (GRCm39) noncoding transcript Het
Gnas A T 2: 174,139,873 (GRCm39) D14V probably damaging Het
Gnl3 T C 14: 30,739,286 (GRCm39) S53G probably damaging Het
Grhl3 C T 4: 135,275,777 (GRCm39) V527M probably damaging Het
Hoxd10 T A 2: 74,524,531 (GRCm39) L281* probably null Het
Kif16b T G 2: 142,532,614 (GRCm39) Y1175S probably benign Het
Kif2b A G 11: 91,467,672 (GRCm39) S204P probably benign Het
Klhl40 T A 9: 121,607,800 (GRCm39) I320N probably damaging Het
Ksr2 G A 5: 117,846,212 (GRCm39) R693Q probably damaging Het
Mis12 A G 11: 70,916,152 (GRCm39) K62E possibly damaging Het
Mlc1 A G 15: 88,858,980 (GRCm39) C102R probably damaging Het
Muc5b T C 7: 141,411,098 (GRCm39) I1348T unknown Het
Myh7b A G 2: 155,471,242 (GRCm39) E1130G probably damaging Het
Nat8f4 T C 6: 85,878,368 (GRCm39) T52A probably benign Het
Nxpe2 C A 9: 48,231,821 (GRCm39) V379L probably benign Het
Or10ad1c G A 15: 98,084,749 (GRCm39) R310W probably damaging Het
Or4c1 C A 2: 89,133,246 (GRCm39) S230I possibly damaging Het
Or4c1 T A 2: 89,133,247 (GRCm39) S230C probably damaging Het
Or5b111 A T 19: 13,291,081 (GRCm39) D189E probably benign Het
Or5b12 C T 19: 12,897,298 (GRCm39) C125Y probably damaging Het
Pcdhga7 A T 18: 37,850,261 (GRCm39) Y756F probably damaging Het
Pcsk6 T A 7: 65,608,989 (GRCm39) Y284N probably damaging Het
Pdcd11 T C 19: 47,114,786 (GRCm39) V1367A possibly damaging Het
Postn T A 3: 54,282,492 (GRCm39) N484K probably damaging Het
Prkd3 C T 17: 79,268,600 (GRCm39) V572I probably benign Het
Qser1 T C 2: 104,617,528 (GRCm39) S1005G probably benign Het
Radil G T 5: 142,472,556 (GRCm39) D951E probably benign Het
Ripk1 C T 13: 34,211,925 (GRCm39) R352* probably null Het
Sacs T C 14: 61,450,196 (GRCm39) F4081L probably benign Het
Sbf1 A G 15: 89,199,288 (GRCm39) V11A possibly damaging Het
Sgip1 T A 4: 102,791,784 (GRCm39) F536I probably damaging Het
Slc45a1 A G 4: 150,722,741 (GRCm39) L381P probably damaging Het
Smarcad1 C T 6: 65,029,625 (GRCm39) P71L probably benign Het
Spns1 T A 7: 125,976,209 (GRCm39) D14V probably damaging Het
Sv2c T A 13: 96,122,526 (GRCm39) I417F possibly damaging Het
Tas2r113 T A 6: 132,870,479 (GRCm39) M169K probably benign Het
Tgm1 A T 14: 55,943,138 (GRCm39) N567K probably benign Het
Thoc2l A G 5: 104,670,106 (GRCm39) K1543E probably benign Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Tspan18 A T 2: 93,142,375 (GRCm39) probably null Het
Usf1 G T 1: 171,244,532 (GRCm39) G144V possibly damaging Het
Vmn1r59 T C 7: 5,457,451 (GRCm39) Y103C probably damaging Het
Vmn2r23 A T 6: 123,718,785 (GRCm39) I713F probably damaging Het
Vmn2r79 A T 7: 86,687,168 (GRCm39) I850F probably damaging Het
Vps35l T A 7: 118,390,671 (GRCm39) I455N probably damaging Het
Wdr90 C T 17: 26,074,337 (GRCm39) R676H probably benign Het
Zfp867 G A 11: 59,354,487 (GRCm39) R281W probably damaging Het
Zfp939 T C 7: 39,122,366 (GRCm39) noncoding transcript Het
Other mutations in Txndc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Txndc11 APN 16 10,922,496 (GRCm39) missense probably damaging 0.96
IGL00563:Txndc11 APN 16 10,922,496 (GRCm39) missense probably damaging 0.96
IGL02576:Txndc11 APN 16 10,892,881 (GRCm39) unclassified probably benign
IGL03070:Txndc11 APN 16 10,893,151 (GRCm39) missense probably damaging 0.97
P0047:Txndc11 UTSW 16 10,909,661 (GRCm39) splice site probably benign
R0091:Txndc11 UTSW 16 10,905,968 (GRCm39) missense probably benign
R0448:Txndc11 UTSW 16 10,909,625 (GRCm39) missense probably damaging 0.99
R0796:Txndc11 UTSW 16 10,952,338 (GRCm39) small deletion probably benign
R0960:Txndc11 UTSW 16 10,909,453 (GRCm39) missense probably benign 0.28
R1184:Txndc11 UTSW 16 10,946,364 (GRCm39) missense probably benign 0.03
R1327:Txndc11 UTSW 16 10,934,678 (GRCm39) missense possibly damaging 0.86
R1441:Txndc11 UTSW 16 10,952,414 (GRCm39) start gained probably benign
R1515:Txndc11 UTSW 16 10,892,926 (GRCm39) missense probably damaging 0.98
R1699:Txndc11 UTSW 16 10,905,639 (GRCm39) critical splice donor site probably null
R1709:Txndc11 UTSW 16 10,946,565 (GRCm39) nonsense probably null
R1850:Txndc11 UTSW 16 10,906,268 (GRCm39) missense probably damaging 0.98
R2026:Txndc11 UTSW 16 10,952,338 (GRCm39) small deletion probably benign
R3433:Txndc11 UTSW 16 10,906,052 (GRCm39) missense probably benign
R4468:Txndc11 UTSW 16 10,893,087 (GRCm39) missense probably benign 0.01
R4469:Txndc11 UTSW 16 10,893,087 (GRCm39) missense probably benign 0.01
R4652:Txndc11 UTSW 16 10,892,986 (GRCm39) missense probably benign
R4675:Txndc11 UTSW 16 10,902,745 (GRCm39) missense possibly damaging 0.65
R4907:Txndc11 UTSW 16 10,906,398 (GRCm39) missense probably benign 0.17
R5205:Txndc11 UTSW 16 10,946,529 (GRCm39) missense probably damaging 0.98
R5273:Txndc11 UTSW 16 10,946,487 (GRCm39) missense probably benign 0.07
R5865:Txndc11 UTSW 16 10,940,552 (GRCm39) missense probably damaging 1.00
R5873:Txndc11 UTSW 16 10,893,069 (GRCm39) missense probably damaging 1.00
R5941:Txndc11 UTSW 16 10,892,935 (GRCm39) missense probably benign 0.04
R6360:Txndc11 UTSW 16 10,902,656 (GRCm39) missense probably damaging 1.00
R6894:Txndc11 UTSW 16 10,906,009 (GRCm39) missense probably damaging 1.00
R7285:Txndc11 UTSW 16 10,902,163 (GRCm39) missense probably damaging 0.98
R7334:Txndc11 UTSW 16 10,946,425 (GRCm39) missense probably damaging 1.00
R7502:Txndc11 UTSW 16 10,905,742 (GRCm39) missense probably benign 0.08
R7660:Txndc11 UTSW 16 10,905,793 (GRCm39) missense probably damaging 1.00
R7677:Txndc11 UTSW 16 10,952,338 (GRCm39) small deletion probably benign
R7683:Txndc11 UTSW 16 10,902,099 (GRCm39) missense probably damaging 1.00
R8315:Txndc11 UTSW 16 10,893,465 (GRCm39) missense possibly damaging 0.70
R9395:Txndc11 UTSW 16 10,902,683 (GRCm39) missense probably benign 0.03
R9406:Txndc11 UTSW 16 10,893,498 (GRCm39) missense probably benign 0.45
R9494:Txndc11 UTSW 16 10,952,156 (GRCm39) missense probably damaging 1.00
X0020:Txndc11 UTSW 16 10,902,082 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGATCATTAACTTCCAGCCCAC -3'
(R):5'- TTGTGGTGGAACATGAGCAG -3'

Sequencing Primer
(F):5'- GATTTCTGAGTTCGAGGCCAACC -3'
(R):5'- CATGAGCAGATTACATGGTGC -3'
Posted On 2015-10-21