Mutagenetix > Incidental Mutation

Incidental Mutation 'R4697:Sbf1'

386443

Institutional Source

Beutler Lab

Gene Symbol

Sbf1

Ensembl Gene

ENSMUSG00000036529

Gene Name

SET binding factor 1

Synonyms

B230113C15Rik, 2610510A08Rik, Mtmr5

MMRRC Submission

041947-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.507) question?

Stock #

R4697 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

89288236-89315311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89315085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 11 (V11A)

Ref Sequence

ENSEMBL: ENSMUSP00000115740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585]

AlphaFold

Q6ZPE2

Predicted Effect

probably benign
Transcript: ENSMUST00000123791
AA Change: V11A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: V11A

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	540	764	4.1e-110	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1100	1534	6.2e-114	PFAM
low complexity region	1614	1621	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	1719	1750	N/A	INTRINSIC
PH	1762	1867	6.45e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124576
AA Change: V11A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529
AA Change: V11A

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
Pfam:dDENN	363	403	4.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144585
AA Change: V11A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: V11A

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	542	764	2.3e-108	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1106	1558	5.7e-93	PFAM
low complexity region	1640	1647	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
low complexity region	1745	1776	N/A	INTRINSIC
PH	1788	1893	6.45e-17	SMART

Meta Mutation Damage Score

0.2439

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,791,448	I455N	probably damaging	Het
A2m	T	C	6: 121,638,284	M1T	probably null	Het
Aatf	T	A	11: 84,449,138	D449V	probably damaging	Het
Acbd3	T	A	1: 180,721,944		probably benign	Het
BC005561	A	G	5: 104,522,240	K1543E	probably benign	Het
Bicc1	T	A	10: 70,953,484	I366F	possibly damaging	Het
Ccdc74a	T	C	16: 17,649,749	S184P	possibly damaging	Het
Cntn4	T	C	6: 106,525,485	V401A	probably damaging	Het
Cux2	T	C	5: 121,873,753	T540A	probably damaging	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dpp7	A	G	2: 25,354,919	Y209H	probably benign	Het
Dstyk	T	A	1: 132,449,487	F277Y	probably damaging	Het
Dtx1	A	T	5: 120,694,408		probably null	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Ednra	T	C	8: 77,664,995	H422R	probably benign	Het
Erlec1	T	A	11: 30,952,640	I67F	probably benign	Het
Fam161b	G	A	12: 84,348,558		probably benign	Het
Gata5	A	T	2: 180,327,379	C345*	probably null	Het
Glmp	T	C	3: 88,328,274	V47A	probably damaging	Het
Gm9762	T	A	3: 78,966,550		noncoding transcript	Het
Gnas	A	T	2: 174,298,080	D14V	probably damaging	Het
Gnl3	T	C	14: 31,017,329	S53G	probably damaging	Het
Grhl3	C	T	4: 135,548,466	V527M	probably damaging	Het
Hoxd10	T	A	2: 74,694,187	L281*	probably null	Het
Kif16b	T	G	2: 142,690,694	Y1175S	probably benign	Het
Kif2b	A	G	11: 91,576,846	S204P	probably benign	Het
Klhl40	T	A	9: 121,778,734	I320N	probably damaging	Het
Ksr2	G	A	5: 117,708,147	R693Q	probably damaging	Het
Mis12	A	G	11: 71,025,326	K62E	possibly damaging	Het
Mlc1	A	G	15: 88,974,777	C102R	probably damaging	Het
Muc5b	T	C	7: 141,857,361	I1348T	unknown	Het
Myh7b	A	G	2: 155,629,322	E1130G	probably damaging	Het
Nat8f4	T	C	6: 85,901,386	T52A	probably benign	Het
Nxpe2	C	A	9: 48,320,521	V379L	probably benign	Het
Olfr1231	C	A	2: 89,302,902	S230I	possibly damaging	Het
Olfr1231	T	A	2: 89,302,903	S230C	probably damaging	Het
Olfr1448	C	T	19: 12,919,934	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,313,717	D189E	probably benign	Het
Olfr288	G	A	15: 98,186,868	R310W	probably damaging	Het
Pcdhga7	A	T	18: 37,717,208	Y756F	probably damaging	Het
Pcsk6	T	A	7: 65,959,241	Y284N	probably damaging	Het
Pdcd11	T	C	19: 47,126,347	V1367A	possibly damaging	Het
Postn	T	A	3: 54,375,071	N484K	probably damaging	Het
Prkd3	C	T	17: 78,961,171	V572I	probably benign	Het
Qser1	T	C	2: 104,787,183	S1005G	probably benign	Het
Radil	G	T	5: 142,486,801	D951E	probably benign	Het
Ripk1	C	T	13: 34,027,942	R352*	probably null	Het
Sacs	T	C	14: 61,212,747	F4081L	probably benign	Het
Sgip1	T	A	4: 102,934,587	F536I	probably damaging	Het
Slc45a1	A	G	4: 150,638,284	L381P	probably damaging	Het
Smarcad1	C	T	6: 65,052,641	P71L	probably benign	Het
Spns1	T	A	7: 126,377,037	D14V	probably damaging	Het
Sv2c	T	A	13: 95,986,018	I417F	possibly damaging	Het
Tas2r113	T	A	6: 132,893,516	M169K	probably benign	Het
Tgm1	A	T	14: 55,705,681	N567K	probably benign	Het
Tln2	C	T	9: 67,395,461	R76Q	probably damaging	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Tspan18	A	T	2: 93,312,030		probably null	Het
Txndc11	C	T	16: 11,084,314	V679I	probably damaging	Het
Usf1	G	T	1: 171,416,964	G144V	possibly damaging	Het
Vmn1r59	T	C	7: 5,454,452	Y103C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,826	I713F	probably damaging	Het
Vmn2r79	A	T	7: 87,037,960	I850F	probably damaging	Het
Wdr90	C	T	17: 25,855,363	R676H	probably benign	Het
Zfp867	G	A	11: 59,463,661	R281W	probably damaging	Het
Zfp939	T	C	7: 39,472,942		noncoding transcript	Het

Other mutations in Sbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00265:Sbf1	APN	15	89305575	missense	probably damaging	0.98
IGL01478:Sbf1	APN	15	89299743	missense	probably damaging	0.97
IGL01533:Sbf1	APN	15	89288716	missense	probably damaging	0.99
IGL01603:Sbf1	APN	15	89303278	missense	probably damaging	1.00
IGL01758:Sbf1	APN	15	89303215	unclassified	probably benign
IGL01908:Sbf1	APN	15	89302726	missense	probably damaging	1.00
IGL02067:Sbf1	APN	15	89289044	missense	probably damaging	1.00
IGL02089:Sbf1	APN	15	89302505	nonsense	probably null
IGL02150:Sbf1	APN	15	89295480	missense	probably benign	0.00
IGL02284:Sbf1	APN	15	89305078	missense	probably damaging	1.00
IGL02367:Sbf1	APN	15	89307572	missense	probably damaging	0.99
IGL02427:Sbf1	APN	15	89305985	unclassified	probably benign
IGL03025:Sbf1	APN	15	89289645	missense	probably damaging	1.00
IGL03103:Sbf1	APN	15	89293947	missense	probably damaging	1.00
IGL03226:Sbf1	APN	15	89289105	missense	possibly damaging	0.93
IGL03376:Sbf1	APN	15	89289016	unclassified	probably benign
IGL03397:Sbf1	APN	15	89288721	missense	probably damaging	1.00
R0043:Sbf1	UTSW	15	89295561	missense	probably benign	0.26
R0139:Sbf1	UTSW	15	89302498	missense	probably damaging	1.00
R0528:Sbf1	UTSW	15	89288712	missense	probably damaging	0.99
R0624:Sbf1	UTSW	15	89302329	missense	possibly damaging	0.68
R0759:Sbf1	UTSW	15	89304716	missense	probably damaging	1.00
R1555:Sbf1	UTSW	15	89305076	missense	probably damaging	1.00
R1763:Sbf1	UTSW	15	89294425	missense	probably damaging	1.00
R2025:Sbf1	UTSW	15	89302730	missense	probably damaging	1.00
R2207:Sbf1	UTSW	15	89306693	missense	possibly damaging	0.88
R2844:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R2845:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R3788:Sbf1	UTSW	15	89299528	nonsense	probably null
R4108:Sbf1	UTSW	15	89288585	unclassified	probably benign
R4403:Sbf1	UTSW	15	89293954	missense	possibly damaging	0.94
R4605:Sbf1	UTSW	15	89303481	missense	probably damaging	1.00
R4620:Sbf1	UTSW	15	89306926	missense	probably damaging	0.99
R4666:Sbf1	UTSW	15	89295246	missense	probably damaging	1.00
R4696:Sbf1	UTSW	15	89303112	nonsense	probably null
R4747:Sbf1	UTSW	15	89302713	missense	probably damaging	1.00
R5828:Sbf1	UTSW	15	89288634	missense	probably damaging	1.00
R5841:Sbf1	UTSW	15	89308068	missense	probably damaging	1.00
R6185:Sbf1	UTSW	15	89305611	missense	probably damaging	1.00
R6237:Sbf1	UTSW	15	89293476	missense	probably benign	0.29
R6256:Sbf1	UTSW	15	89300867	missense	probably benign	0.06
R6490:Sbf1	UTSW	15	89304908	missense	probably benign
R6933:Sbf1	UTSW	15	89300369	missense	probably damaging	1.00
R7806:Sbf1	UTSW	15	89305420	missense	possibly damaging	0.52
R7921:Sbf1	UTSW	15	89306223	missense	probably damaging	0.96
R8005:Sbf1	UTSW	15	89294205	missense	probably damaging	0.98
R8350:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8450:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8509:Sbf1	UTSW	15	89293457	missense	probably damaging	1.00
R8753:Sbf1	UTSW	15	89295459	missense	probably benign
R8788:Sbf1	UTSW	15	89301859	missense	probably damaging	1.00
R9182:Sbf1	UTSW	15	89289603	critical splice donor site	probably null
R9516:Sbf1	UTSW	15	89300539	missense	probably damaging	1.00
R9608:Sbf1	UTSW	15	89307605	critical splice acceptor site	probably null
R9673:Sbf1	UTSW	15	89295472	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- ATAACTACGGAGGCCTCTTTTC -3'
(R):5'- CCTTGAGCATGAGGTAGTAGG -3'

Sequencing Primer
(F):5'- TCTTTTCGAGAGCCCCGAGAG -3'
(R):5'- CCAATGGAAGCGCACTGTG -3'

Posted On

2016-06-01