Mutagenetix > Incidental Mutations

Incidental Mutation 'R0403:Ace'

35724

Institutional Source

Beutler Lab

Gene Symbol

Ace

Ensembl Gene

ENSMUSG00000020681

Gene Name

angiotensin I converting enzyme (peptidyl-dipeptidase A) 1

Synonyms

CD143

MMRRC Submission

038608-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0403 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105967945-105989964 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 105973880 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]

Predicted Effect

probably null
Transcript: ENSMUST00000001963

SMART Domains

Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Peptidase_M2	45	628	7.1e-257	PFAM
Pfam:Peptidase_M2	648	1226	8.9e-261	PFAM
transmembrane domain	1264	1286	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000001964

SMART Domains

Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Peptidase_M2	59	653	N/A	PFAM
transmembrane domain	684	706	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130673

Predicted Effect

probably null
Transcript: ENSMUST00000132280

SMART Domains

Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M2	1	395	2.4e-201	PFAM
Pfam:Peptidase_M2	415	993	1.4e-261	PFAM
low complexity region	999	1014	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151657

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152925

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.0%
3x: 96.8%
10x: 93.2%
20x: 83.7%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg3	C	T	8: 95,036,922	L284F	probably benign	Het
Alkbh8	T	A	9: 3,385,469	V587E	probably damaging	Het
Ap4b1	T	A	3: 103,818,839	C244S	probably damaging	Het
Ap4b1	T	A	3: 103,821,396	M590K	probably benign	Het
Arhgap15	C	T	2: 44,063,766	T168I	probably damaging	Het
Arntl2	T	A	6: 146,822,655	H348Q	probably damaging	Het
Atp8b1	A	G	18: 64,540,310	V997A	probably damaging	Het
Atrn	G	A	2: 130,906,859	C100Y	probably damaging	Het
Baiap2l2	C	A	15: 79,271,216	A151S	probably benign	Het
Baz2b	A	T	2: 59,969,377	D199E	possibly damaging	Het
Cblb	A	G	16: 52,152,626	D440G	probably benign	Het
Cdon	T	C	9: 35,473,500	V694A	probably benign	Het
Cep250	A	T	2: 155,992,349	R2065W	probably damaging	Het
Ces2b	G	T	8: 104,833,945	A131S	probably damaging	Het
Chrna9	A	T	5: 65,967,892	T59S	possibly damaging	Het
Cog3	T	A	14: 75,742,327		probably benign	Het
Cpa1	G	A	6: 30,641,857	V227I	probably benign	Het
Cyp3a25	A	T	5: 145,998,513	C98S	probably damaging	Het
D8Ertd738e	C	T	8: 84,249,601		probably null	Het
Ddx60	A	G	8: 61,994,541		probably benign	Het
Dhx16	T	C	17: 35,883,050		probably null	Het
Dnah9	T	A	11: 66,084,789	Q1478L	possibly damaging	Het
Dock10	T	C	1: 80,524,070	Y1434C	possibly damaging	Het
Enpp3	T	A	10: 24,804,436	D325V	probably damaging	Het
Entpd6	C	A	2: 150,760,170	T194K	possibly damaging	Het
Fam208b	A	T	13: 3,582,052	Y816*	probably null	Het
Fat2	A	T	11: 55,270,349	V3185E	probably benign	Het
Flrt1	A	G	19: 7,095,919	L421P	probably benign	Het
Fmn2	A	T	1: 174,694,278	Q1292L	probably damaging	Het
Fndc1	T	C	17: 7,775,588		probably null	Het
Fndc1	T	C	17: 7,753,723	D1459G	probably damaging	Het
Fzr1	A	G	10: 81,369,368	S265P	possibly damaging	Het
Gm13119	A	G	4: 144,362,646	N178S	probably benign	Het
Gm14085	T	C	2: 122,521,854	L364S	probably damaging	Het
Gpr142	G	A	11: 114,806,029	V134M	probably damaging	Het
Grid2ip	G	T	5: 143,357,620	V24L	possibly damaging	Het
Herc2	G	A	7: 56,159,417	R2555H	probably damaging	Het
Hpdl	A	T	4: 116,820,479	Y262N	possibly damaging	Het
Htr3a	A	G	9: 48,908,659	V57A	probably damaging	Het
Igfbp7	T	C	5: 77,355,591	I186V	probably benign	Het
Itga2b	C	T	11: 102,467,326		probably null	Het
Itgae	A	C	11: 73,123,183	D736A	possibly damaging	Het
Itpkc	T	A	7: 27,208,345	M645L	probably benign	Het
Jchain	T	C	5: 88,521,378	R139G	probably benign	Het
Kif13a	A	G	13: 46,791,401	V908A	probably damaging	Het
Kif1b	T	A	4: 149,181,967	K389*	probably null	Het
Klhl12	T	C	1: 134,485,856	Y360H	possibly damaging	Het
Knop1	G	A	7: 118,853,053	R148W	probably damaging	Het
Lpar1	T	A	4: 58,487,191	N27Y	probably damaging	Het
Lpar2	T	A	8: 69,824,152	V197D	probably damaging	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Lum	G	T	10: 97,572,043	V337F	probably benign	Het
Mag	T	C	7: 30,906,980	D344G	probably damaging	Het
Maip1	G	A	1: 57,407,196	A142T	probably benign	Het
Mlh3	A	G	12: 85,268,968	V148A	possibly damaging	Het
Nav3	A	G	10: 109,767,103	V1195A	probably damaging	Het
Ncor2	A	G	5: 125,033,337	S868P	possibly damaging	Het
Nek1	A	G	8: 61,106,855	E907G	probably damaging	Het
Nfam1	G	A	15: 83,016,379	T134I	probably benign	Het
Nr0b2	T	C	4: 133,553,759	V112A	probably damaging	Het
Nrp1	A	G	8: 128,457,969	N365S	probably damaging	Het
Nrsn2	T	C	2: 152,369,790	Y107C	probably damaging	Het
Ntng1	G	A	3: 109,934,611	A282V	probably damaging	Het
Nxf1	T	C	19: 8,765,028	I337T	probably damaging	Het
Obscn	C	T	11: 59,076,540	G479D	probably damaging	Het
Olfr45	T	C	7: 140,691,309	S135P	possibly damaging	Het
Oprd1	T	A	4: 132,113,768	D293V	probably benign	Het
P3h2	T	G	16: 25,969,950	N586H	possibly damaging	Het
Pcid2	T	C	8: 13,085,367	Y214C	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Ppic	C	A	18: 53,411,071	G81W	probably damaging	Het
Ppp2r1a	C	A	17: 20,957,041	P246T	probably damaging	Het
Ppp4r4	T	G	12: 103,584,102	S46A	probably benign	Het
Prkce	A	G	17: 86,168,653	T21A	probably damaging	Het
Prkg2	T	C	5: 98,994,645	E210G	possibly damaging	Het
Prss35	A	G	9: 86,756,037	M287V	probably damaging	Het
Psd	G	A	19: 46,320,972		probably benign	Het
Ptch2	A	T	4: 117,110,839	K843*	probably null	Het
Rab44	C	A	17: 29,145,261	T603K	probably damaging	Het
Rasal3	T	A	17: 32,392,790		probably null	Het
Rbbp6	A	G	7: 122,992,296	T526A	probably damaging	Het
Ros1	A	T	10: 52,143,438		probably benign	Het
Sec24b	T	A	3: 129,989,676	L1104F	possibly damaging	Het
Sec24b	A	G	3: 129,999,534	S685P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Setmar	A	T	6: 108,075,962	H139L	probably benign	Het
Slc4a7	T	C	14: 14,766,808	V710A	probably benign	Het
Smarcc1	T	A	9: 110,237,808		probably null	Het
Smchd1	G	A	17: 71,394,902	L1032F	probably damaging	Het
Speg	T	C	1: 75,430,784		probably benign	Het
Tcea1	C	G	1: 4,889,503	R134G	probably benign	Het
Tchhl1	C	T	3: 93,471,029	Q347*	probably null	Het
Tecrl	A	T	5: 83,354,758		probably benign	Het
Tepsin	T	C	11: 120,093,682		probably benign	Het
Tmem40	G	A	6: 115,733,985		probably benign	Het
Tpr	G	A	1: 150,407,414		probably benign	Het
Ttll12	A	T	15: 83,580,658		probably benign	Het
Ttn	T	A	2: 76,909,608	D3529V	probably benign	Het
Usp34	T	A	11: 23,333,838	H177Q	possibly damaging	Het
Vsig10	T	A	5: 117,338,461	S327T	probably benign	Het
Zbtb4	T	A	11: 69,777,639	M396K	probably damaging	Het
Zfp352	C	T	4: 90,225,009	T462I	possibly damaging	Het
Zfp385b	T	C	2: 77,476,845	M145V	probably damaging	Het
Zfp780b	C	A	7: 27,971,689	V65F	possibly damaging	Het

Other mutations in Ace

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00941:Ace	APN	11	105979550	missense	probably benign	0.21
IGL01105:Ace	APN	11	105972059	missense	probably damaging	1.00
IGL01761:Ace	APN	11	105979493	missense	possibly damaging	0.70
IGL01888:Ace	APN	11	105968944	missense	probably benign
IGL02173:Ace	APN	11	105988991	missense	probably benign	0.04
IGL02179:Ace	APN	11	105969789	missense	probably benign	0.16
IGL02331:Ace	APN	11	105971344	missense	possibly damaging	0.61
IGL02333:Ace	APN	11	105971447	missense	probably benign
IGL02556:Ace	APN	11	105972527	missense	probably damaging	1.00
IGL02576:Ace	APN	11	105974111	missense	probably damaging	1.00
IGL03202:Ace	APN	11	105976962	missense	probably damaging	1.00
R0709:Ace	UTSW	11	105981538	missense	probably damaging	0.97
R1555:Ace	UTSW	11	105974901	intron	probably null
R1603:Ace	UTSW	11	105972099	missense	probably benign	0.23
R1644:Ace	UTSW	11	105985106	missense	probably damaging	1.00
R1834:Ace	UTSW	11	105986094	splice site	probably benign
R2074:Ace	UTSW	11	105976623	nonsense	probably null
R3025:Ace	UTSW	11	105974093	splice site	probably null
R3176:Ace	UTSW	11	105976702	missense	probably null	1.00
R3276:Ace	UTSW	11	105976702	missense	probably null	1.00
R3977:Ace	UTSW	11	105981838	missense	possibly damaging	0.96
R4506:Ace	UTSW	11	105976666	missense	probably damaging	0.98
R4598:Ace	UTSW	11	105981759	splice site	probably null
R4914:Ace	UTSW	11	105979597	missense	probably damaging	1.00
R4968:Ace	UTSW	11	105981853	missense	possibly damaging	0.93
R5137:Ace	UTSW	11	105974826	missense	probably damaging	1.00
R5274:Ace	UTSW	11	105968037	missense	probably benign
R5332:Ace	UTSW	11	105973879	critical splice donor site	probably null
R5388:Ace	UTSW	11	105988458	missense	possibly damaging	0.85
R5425:Ace	UTSW	11	105973428	missense	probably damaging	1.00
R5640:Ace	UTSW	11	105970685	missense	probably damaging	1.00
R5838:Ace	UTSW	11	105972880	missense	probably benign	0.00
R6041:Ace	UTSW	11	105975308	missense	probably benign	0.27
R6083:Ace	UTSW	11	105985267	nonsense	probably null
R6106:Ace	UTSW	11	105989012	missense	probably damaging	1.00
R6225:Ace	UTSW	11	105979619	missense	possibly damaging	0.51
R6607:Ace	UTSW	11	105972377	missense	possibly damaging	0.82
R6918:Ace	UTSW	11	105972943	missense	probably damaging	1.00
R7330:Ace	UTSW	11	105986061	missense	probably damaging	1.00
R7471:Ace	UTSW	11	105973482	missense	probably damaging	1.00
R7709:Ace	UTSW	11	105988837	missense	probably benign	0.01
R7800:Ace	UTSW	11	105986058	missense	probably damaging	1.00
R7855:Ace	UTSW	11	105972379	missense	probably benign	0.05
R7938:Ace	UTSW	11	105972379	missense	probably benign	0.05
R8063:Ace	UTSW	11	105971364	missense	possibly damaging	0.90
R8072:Ace	UTSW	11	105972959	missense	probably damaging	0.98
X0018:Ace	UTSW	11	105971384	missense	probably damaging	1.00
X0063:Ace	UTSW	11	105975638	missense	probably benign	0.07
Z1177:Ace	UTSW	11	105988134	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCGGTATCTTTTCTGCCAGTC -3'
(R):5'- TCCTTGCACAGTGCTTGATGGAAC -3'

Sequencing Primer
(F):5'- TCTCAGGCAACGTGTACAG -3'
(R):5'- GCTTGATGGAACTGGAACTGC -3'

Posted On

2013-05-09