Mutagenetix > Incidental Mutations

Incidental Mutation 'R0403:Ppp4r4'

35729

Institutional Source

Beutler Lab

Gene Symbol

Ppp4r4

Ensembl Gene

ENSMUSG00000021209

Gene Name

protein phosphatase 4, regulatory subunit 4

Synonyms

8430415E04Rik

MMRRC Submission

038608-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R0403 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

103532283-103613831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 103584102 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 46 (S46A)

Ref Sequence

ENSEMBL: ENSMUSP00000140295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190664]

Predicted Effect

probably benign
Transcript: ENSMUST00000021631
AA Change: S262A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209
AA Change: S262A

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	55	577	6e-27	SMART
PDB:3FGA\|A	178	666	8e-6	PDB
coiled coil region	690	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187155
AA Change: S153A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209
AA Change: S153A

Domain	Start	End	E-Value	Type
Pfam:HEAT	145	175	2.8e-3	PFAM
low complexity region	484	495	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189871
AA Change: S262A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209
AA Change: S262A

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	95	577	7e-26	SMART
PDB:1B3U\|B	178	666	2e-6	PDB
coiled coil region	690	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190664
AA Change: S46A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000140295
Gene: ENSMUSG00000021209
AA Change: S46A

Domain	Start	End	E-Value	Type
Pfam:HEAT	38	68	5.8e-4	PFAM

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 98.0%
3x: 96.8%
10x: 93.2%
20x: 83.7%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	A	G	11: 105,973,880		probably null	Het
Adgrg3	C	T	8: 95,036,922	L284F	probably benign	Het
Alkbh8	T	A	9: 3,385,469	V587E	probably damaging	Het
Ap4b1	T	A	3: 103,818,839	C244S	probably damaging	Het
Ap4b1	T	A	3: 103,821,396	M590K	probably benign	Het
Arhgap15	C	T	2: 44,063,766	T168I	probably damaging	Het
Arntl2	T	A	6: 146,822,655	H348Q	probably damaging	Het
Atp8b1	A	G	18: 64,540,310	V997A	probably damaging	Het
Atrn	G	A	2: 130,906,859	C100Y	probably damaging	Het
Baiap2l2	C	A	15: 79,271,216	A151S	probably benign	Het
Baz2b	A	T	2: 59,969,377	D199E	possibly damaging	Het
Cblb	A	G	16: 52,152,626	D440G	probably benign	Het
Cdon	T	C	9: 35,473,500	V694A	probably benign	Het
Cep250	A	T	2: 155,992,349	R2065W	probably damaging	Het
Ces2b	G	T	8: 104,833,945	A131S	probably damaging	Het
Chrna9	A	T	5: 65,967,892	T59S	possibly damaging	Het
Cog3	T	A	14: 75,742,327		probably benign	Het
Cpa1	G	A	6: 30,641,857	V227I	probably benign	Het
Cyp3a25	A	T	5: 145,998,513	C98S	probably damaging	Het
D8Ertd738e	C	T	8: 84,249,601		probably null	Het
Ddx60	A	G	8: 61,994,541		probably benign	Het
Dhx16	T	C	17: 35,883,050		probably null	Het
Dnah9	T	A	11: 66,084,789	Q1478L	possibly damaging	Het
Dock10	T	C	1: 80,524,070	Y1434C	possibly damaging	Het
Enpp3	T	A	10: 24,804,436	D325V	probably damaging	Het
Entpd6	C	A	2: 150,760,170	T194K	possibly damaging	Het
Fam208b	A	T	13: 3,582,052	Y816*	probably null	Het
Fat2	A	T	11: 55,270,349	V3185E	probably benign	Het
Flrt1	A	G	19: 7,095,919	L421P	probably benign	Het
Fmn2	A	T	1: 174,694,278	Q1292L	probably damaging	Het
Fndc1	T	C	17: 7,775,588		probably null	Het
Fndc1	T	C	17: 7,753,723	D1459G	probably damaging	Het
Fzr1	A	G	10: 81,369,368	S265P	possibly damaging	Het
Gm13119	A	G	4: 144,362,646	N178S	probably benign	Het
Gm14085	T	C	2: 122,521,854	L364S	probably damaging	Het
Gpr142	G	A	11: 114,806,029	V134M	probably damaging	Het
Grid2ip	G	T	5: 143,357,620	V24L	possibly damaging	Het
Herc2	G	A	7: 56,159,417	R2555H	probably damaging	Het
Hpdl	A	T	4: 116,820,479	Y262N	possibly damaging	Het
Htr3a	A	G	9: 48,908,659	V57A	probably damaging	Het
Igfbp7	T	C	5: 77,355,591	I186V	probably benign	Het
Itga2b	C	T	11: 102,467,326		probably null	Het
Itgae	A	C	11: 73,123,183	D736A	possibly damaging	Het
Itpkc	T	A	7: 27,208,345	M645L	probably benign	Het
Jchain	T	C	5: 88,521,378	R139G	probably benign	Het
Kif13a	A	G	13: 46,791,401	V908A	probably damaging	Het
Kif1b	T	A	4: 149,181,967	K389*	probably null	Het
Klhl12	T	C	1: 134,485,856	Y360H	possibly damaging	Het
Knop1	G	A	7: 118,853,053	R148W	probably damaging	Het
Lpar1	T	A	4: 58,487,191	N27Y	probably damaging	Het
Lpar2	T	A	8: 69,824,152	V197D	probably damaging	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Lum	G	T	10: 97,572,043	V337F	probably benign	Het
Mag	T	C	7: 30,906,980	D344G	probably damaging	Het
Maip1	G	A	1: 57,407,196	A142T	probably benign	Het
Mlh3	A	G	12: 85,268,968	V148A	possibly damaging	Het
Nav3	A	G	10: 109,767,103	V1195A	probably damaging	Het
Ncor2	A	G	5: 125,033,337	S868P	possibly damaging	Het
Nek1	A	G	8: 61,106,855	E907G	probably damaging	Het
Nfam1	G	A	15: 83,016,379	T134I	probably benign	Het
Nr0b2	T	C	4: 133,553,759	V112A	probably damaging	Het
Nrp1	A	G	8: 128,457,969	N365S	probably damaging	Het
Nrsn2	T	C	2: 152,369,790	Y107C	probably damaging	Het
Ntng1	G	A	3: 109,934,611	A282V	probably damaging	Het
Nxf1	T	C	19: 8,765,028	I337T	probably damaging	Het
Obscn	C	T	11: 59,076,540	G479D	probably damaging	Het
Olfr45	T	C	7: 140,691,309	S135P	possibly damaging	Het
Oprd1	T	A	4: 132,113,768	D293V	probably benign	Het
P3h2	T	G	16: 25,969,950	N586H	possibly damaging	Het
Pcid2	T	C	8: 13,085,367	Y214C	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Ppic	C	A	18: 53,411,071	G81W	probably damaging	Het
Ppp2r1a	C	A	17: 20,957,041	P246T	probably damaging	Het
Prkce	A	G	17: 86,168,653	T21A	probably damaging	Het
Prkg2	T	C	5: 98,994,645	E210G	possibly damaging	Het
Prss35	A	G	9: 86,756,037	M287V	probably damaging	Het
Psd	G	A	19: 46,320,972		probably benign	Het
Ptch2	A	T	4: 117,110,839	K843*	probably null	Het
Rab44	C	A	17: 29,145,261	T603K	probably damaging	Het
Rasal3	T	A	17: 32,392,790		probably null	Het
Rbbp6	A	G	7: 122,992,296	T526A	probably damaging	Het
Ros1	A	T	10: 52,143,438		probably benign	Het
Sec24b	T	A	3: 129,989,676	L1104F	possibly damaging	Het
Sec24b	A	G	3: 129,999,534	S685P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Setmar	A	T	6: 108,075,962	H139L	probably benign	Het
Slc4a7	T	C	14: 14,766,808	V710A	probably benign	Het
Smarcc1	T	A	9: 110,237,808		probably null	Het
Smchd1	G	A	17: 71,394,902	L1032F	probably damaging	Het
Speg	T	C	1: 75,430,784		probably benign	Het
Tcea1	C	G	1: 4,889,503	R134G	probably benign	Het
Tchhl1	C	T	3: 93,471,029	Q347*	probably null	Het
Tecrl	A	T	5: 83,354,758		probably benign	Het
Tepsin	T	C	11: 120,093,682		probably benign	Het
Tmem40	G	A	6: 115,733,985		probably benign	Het
Tpr	G	A	1: 150,407,414		probably benign	Het
Ttll12	A	T	15: 83,580,658		probably benign	Het
Ttn	T	A	2: 76,909,608	D3529V	probably benign	Het
Usp34	T	A	11: 23,333,838	H177Q	possibly damaging	Het
Vsig10	T	A	5: 117,338,461	S327T	probably benign	Het
Zbtb4	T	A	11: 69,777,639	M396K	probably damaging	Het
Zfp352	C	T	4: 90,225,009	T462I	possibly damaging	Het
Zfp385b	T	C	2: 77,476,845	M145V	probably damaging	Het
Zfp780b	C	A	7: 27,971,689	V65F	possibly damaging	Het

Other mutations in Ppp4r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Ppp4r4	APN	12	103579076	missense	probably benign
IGL01388:Ppp4r4	APN	12	103576849	missense	probably damaging	1.00
IGL01662:Ppp4r4	APN	12	103602966	missense	possibly damaging	0.55
IGL01768:Ppp4r4	APN	12	103581405	missense	probably benign	0.12
IGL01894:Ppp4r4	APN	12	103593138	missense	probably damaging	1.00
IGL01921:Ppp4r4	APN	12	103576310	start codon destroyed	probably null	0.01
IGL01960:Ppp4r4	APN	12	103581494	splice site	probably benign
IGL02084:Ppp4r4	APN	12	103600398	missense	possibly damaging	0.93
IGL02287:Ppp4r4	APN	12	103587488	missense	probably benign	0.01
IGL02315:Ppp4r4	APN	12	103600361	splice site	probably benign
IGL03137:Ppp4r4	APN	12	103581384	missense	probably damaging	1.00
IGL03170:Ppp4r4	APN	12	103590774	intron	probably benign
cataract	UTSW	12	103612815	nonsense	probably null
downfall	UTSW	12	103593098	missense	probably benign	0.00
R0114:Ppp4r4	UTSW	12	103576374	missense	probably benign	0.00
R0390:Ppp4r4	UTSW	12	103601360	splice site	probably benign
R0548:Ppp4r4	UTSW	12	103612815	nonsense	probably null
R0601:Ppp4r4	UTSW	12	103600520	splice site	probably benign
R0894:Ppp4r4	UTSW	12	103600495	missense	probably damaging	0.99
R1127:Ppp4r4	UTSW	12	103579068	missense	probably damaging	1.00
R1177:Ppp4r4	UTSW	12	103576323	missense	possibly damaging	0.82
R1378:Ppp4r4	UTSW	12	103581492	splice site	probably benign
R1442:Ppp4r4	UTSW	12	103598245	missense	probably damaging	0.97
R1497:Ppp4r4	UTSW	12	103606945	missense	probably benign	0.07
R1651:Ppp4r4	UTSW	12	103584072	missense	probably benign	0.01
R1797:Ppp4r4	UTSW	12	103598151	missense	possibly damaging	0.95
R1880:Ppp4r4	UTSW	12	103605035	missense	possibly damaging	0.62
R2008:Ppp4r4	UTSW	12	103585757	missense	probably damaging	1.00
R2038:Ppp4r4	UTSW	12	103576280	critical splice acceptor site	probably null
R2404:Ppp4r4	UTSW	12	103581490	splice site	probably null
R2696:Ppp4r4	UTSW	12	103581394	missense	possibly damaging	0.77
R2849:Ppp4r4	UTSW	12	103606933	missense	probably benign	0.00
R2965:Ppp4r4	UTSW	12	103612821	missense	probably damaging	1.00
R3030:Ppp4r4	UTSW	12	103606956	missense	probably benign
R3805:Ppp4r4	UTSW	12	103600366	missense	probably damaging	0.99
R3862:Ppp4r4	UTSW	12	103596421	nonsense	probably null
R4194:Ppp4r4	UTSW	12	103558445	missense	probably damaging	1.00
R4320:Ppp4r4	UTSW	12	103598243	missense	probably damaging	1.00
R4558:Ppp4r4	UTSW	12	103606933	missense	probably benign	0.00
R4783:Ppp4r4	UTSW	12	103590858	critical splice donor site	probably null
R4866:Ppp4r4	UTSW	12	103600447	missense	possibly damaging	0.92
R4903:Ppp4r4	UTSW	12	103590771	splice site	probably null
R5309:Ppp4r4	UTSW	12	103606888	splice site	probably null
R5312:Ppp4r4	UTSW	12	103606888	splice site	probably null
R5381:Ppp4r4	UTSW	12	103593098	missense	probably benign	0.00
R5383:Ppp4r4	UTSW	12	103584168	missense	probably benign	0.14
R5447:Ppp4r4	UTSW	12	103584151	missense	possibly damaging	0.67
R5942:Ppp4r4	UTSW	12	103587447	missense	possibly damaging	0.92
R6339:Ppp4r4	UTSW	12	103604969	nonsense	probably null
R6386:Ppp4r4	UTSW	12	103593105	missense	probably damaging	1.00
R6712:Ppp4r4	UTSW	12	103596443	missense	probably damaging	1.00
R6755:Ppp4r4	UTSW	12	103585737	missense	probably damaging	1.00
R6868:Ppp4r4	UTSW	12	103590852	missense	probably damaging	1.00
R6879:Ppp4r4	UTSW	12	103551920	intron	probably null
R7355:Ppp4r4	UTSW	12	103604582	nonsense	probably null
R7397:Ppp4r4	UTSW	12	103612806	critical splice acceptor site	probably null
R7447:Ppp4r4	UTSW	12	103585726	missense	possibly damaging	0.46
R7576:Ppp4r4	UTSW	12	103596449	missense	probably damaging	0.97
R7653:Ppp4r4	UTSW	12	103584145	missense	probably damaging	0.98
R7683:Ppp4r4	UTSW	12	103587105	nonsense	probably null
R7748:Ppp4r4	UTSW	12	103605061	critical splice donor site	probably null
R7831:Ppp4r4	UTSW	12	103590821	missense	possibly damaging	0.76
R7833:Ppp4r4	UTSW	12	103598148	missense	probably benign	0.03
R7914:Ppp4r4	UTSW	12	103590821	missense	possibly damaging	0.76
R7916:Ppp4r4	UTSW	12	103598148	missense	probably benign	0.03
X0025:Ppp4r4	UTSW	12	103600480	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTTCCTCACCAGGTGGCAT -3'
(R):5'- AGGGCTGCTTTCCAAGCCAAATTC -3'

Sequencing Primer
(F):5'- ATGCGTGGGGACGAGAG -3'
(R):5'- CATATGCCAGTCATGTTCTGATGAG -3'

Posted On

2013-05-09