Incidental Mutation 'R4894:Lilra6'
ID377490
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
SynonymsPira3, 7M1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3908280-3915503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3912531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 161 (T161A)
Ref Sequence ENSEMBL: ENSMUSP00000145890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
Predicted Effect probably benign
Transcript: ENSMUST00000038176
AA Change: T402A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: T402A

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090689
AA Change: T364A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: T364A

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131255
Predicted Effect probably benign
Transcript: ENSMUST00000206077
AA Change: T161A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206851
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2411:Lilra6 UTSW 7 3911454 missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4074:Lilra6 UTSW 7 3914890 missense probably benign 0.23
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5048:Lilra6 UTSW 7 3915441 critical splice donor site probably null
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6281:Lilra6 UTSW 7 3911973 missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7017:Lilra6 UTSW 7 3908708 missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
R7747:Lilra6 UTSW 7 3912996 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTTCGAGAACACAGGCTCTCC -3'
(R):5'- CACTATGAACCCAGGCTCTCAG -3'

Sequencing Primer
(F):5'- CGAGAACACAGGCTCTCCATTTTATG -3'
(R):5'- GGAAGATGACACTCCACTGTGC -3'
Posted On2016-03-17