Incidental Mutation 'R4995:Lss'
ID385190
Institutional Source Beutler Lab
Gene Symbol Lss
Ensembl Gene ENSMUSG00000033105
Gene Namelanosterol synthase
Synonyms2810025N20Rik, Osc, D10Ertd116e
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4995 (G1)
Quality Score211
Status Validated
Chromosome10
Chromosomal Location76531588-76557138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76547537 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 557 (V557A)
Ref Sequence ENSEMBL: ENSMUSP00000046856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048678] [ENSMUST00000163049]
Predicted Effect probably benign
Transcript: ENSMUST00000048678
AA Change: V557A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046856
Gene: ENSMUSG00000033105
AA Change: V557A

DomainStartEndE-ValueType
Pfam:SQHop_cyclase_N 80 373 2.4e-47 PFAM
Pfam:Prenyltrans 84 117 3.9e-3 PFAM
Pfam:Prenyltrans 123 166 5.2e-14 PFAM
Pfam:SQHop_cyclase_C 384 722 4.6e-58 PFAM
Pfam:Prenyltrans 560 601 9.9e-14 PFAM
Pfam:Prenyltrans 611 663 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162848
Predicted Effect probably benign
Transcript: ENSMUST00000163049
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the conversion of (S)-2,3 oxidosqualene to lanosterol. The encoded protein is a member of the terpene cyclase/mutase family and catalyzes the first step in the biosynthesis of cholesterol, steroid hormones, and vitamin D. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Lss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Lss APN 10 76536260 missense probably damaging 1.00
IGL02561:Lss APN 10 76540430 unclassified probably benign
IGL02991:Lss APN 10 76543911 unclassified probably benign
IGL03059:Lss APN 10 76532026 splice site probably benign
IGL03328:Lss APN 10 76540951 missense probably damaging 1.00
IGL03389:Lss APN 10 76536339 missense probably damaging 1.00
R1426:Lss UTSW 10 76536303 missense probably damaging 0.98
R1529:Lss UTSW 10 76536289 nonsense probably null
R1727:Lss UTSW 10 76539844 missense possibly damaging 0.95
R1815:Lss UTSW 10 76552964 missense probably damaging 1.00
R1940:Lss UTSW 10 76545462 missense possibly damaging 0.95
R2051:Lss UTSW 10 76531878 missense possibly damaging 0.63
R2061:Lss UTSW 10 76546098 unclassified probably null
R3700:Lss UTSW 10 76546192 missense probably damaging 1.00
R4020:Lss UTSW 10 76547444 missense probably damaging 1.00
R4619:Lss UTSW 10 76536255 missense probably benign 0.11
R5056:Lss UTSW 10 76552926 splice site probably null
R5134:Lss UTSW 10 76546236 unclassified probably benign
R6074:Lss UTSW 10 76543859 missense probably damaging 1.00
R6140:Lss UTSW 10 76550688 missense probably damaging 1.00
R7214:Lss UTSW 10 76547471 missense probably damaging 1.00
R7717:Lss UTSW 10 76545452 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCATGCTTTAACACCCTTGC -3'
(R):5'- GACCTATATACACGGAGACTCAAG -3'

Sequencing Primer
(F):5'- GCTCACCACACTCTGGC -3'
(R):5'- TATATACACGGAGACTCAAGCACAG -3'
Posted On2016-05-10