Mutagenetix > Incidental Mutations

Incidental Mutation 'R4995:Crot'

385160

Institutional Source

Beutler Lab

Gene Symbol

Crot

Ensembl Gene

ENSMUSG00000003623

Gene Name

carnitine O-octanoyltransferase

Synonyms

1200003H03Rik

MMRRC Submission

042589-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R4995 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8966033-8997324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8974000 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 372 (V372E)

Ref Sequence

ENSEMBL: ENSMUSP00000003720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003720]

PDB Structure

Crystal Structure of Mouse Carnitine Octanoyltransferase [X-RAY DIFFRACTION]
Crystal structure of mouse carnitine octanoyltransferase in complex with octanoylcarnitine [X-RAY DIFFRACTION]
C323M mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
M335V mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003720
AA Change: V372E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000003720
Gene: ENSMUSG00000003623
AA Change: V372E

Domain	Start	End	E-Value	Type
Pfam:Carn_acyltransf	20	604	2.3e-167	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146115

Meta Mutation Damage Score

0.6139

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	A	2: 19,494,184	Q333*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acvrl1	G	A	15: 101,135,860	R141H	probably benign	Het
Adprm	A	G	11: 67,041,610	F158L	possibly damaging	Het
Aldoart2	C	T	12: 55,566,253	T321M	probably benign	Het
Ap3m2	A	G	8: 22,803,776	V86A	probably benign	Het
Arhgef19	T	A	4: 141,247,515		probably null	Het
Armc4	G	A	18: 7,223,663	T460M	probably damaging	Het
Bcl2l12	T	G	7: 44,994,191		probably null	Het
Bptf	T	C	11: 107,054,565	Q2501R	probably damaging	Het
C230029F24Rik	A	T	1: 49,338,136		noncoding transcript	Het
C7	C	T	15: 5,049,592	G78D	probably damaging	Het
Caly	T	C	7: 140,070,625	T135A	probably benign	Het
Cbl	A	G	9: 44,153,811	M740T	possibly damaging	Het
Cbx4	A	G	11: 119,081,211	V446A	probably benign	Het
Celsr1	C	A	15: 85,937,911	R1735L	probably damaging	Het
Cep250	A	G	2: 155,988,316	D135G	probably damaging	Het
Cgn	T	C	3: 94,779,936	T19A	probably damaging	Het
Chic2	A	T	5: 75,044,204	V32D	probably damaging	Het
Cntln	A	G	4: 85,049,883	K780E	probably benign	Het
Col8a2	A	T	4: 126,310,788	D197V	probably damaging	Het
Cyb561d2	C	T	9: 107,541,548	V26M	probably damaging	Het
Ddx5	G	A	11: 106,785,236	T237I	probably damaging	Het
Dmxl2	G	T	9: 54,501,441		probably benign	Het
Dock8	T	A	19: 25,158,383	S1188R	probably benign	Het
Ehbp1	T	A	11: 22,101,073	H493L	probably damaging	Het
Eif5b	T	A	1: 38,051,711	*1217K	probably null	Het
Eprs	A	G	1: 185,410,139		probably benign	Het
Etfdh	T	C	3: 79,605,788	D376G	probably benign	Het
Fam186a	T	C	15: 99,945,099	Q1088R	probably benign	Het
Fbxw16	G	T	9: 109,441,250	T141N	probably damaging	Het
Fgf11	G	A	11: 69,798,759	H138Y	probably damaging	Het
Gm1673	G	A	5: 33,984,926	R79H	probably damaging	Het
Htra3	T	C	5: 35,671,074	E154G	probably damaging	Het
Hydin	T	A	8: 110,569,642	V3601D	probably damaging	Het
Jup	G	T	11: 100,379,541	S380*	probably null	Het
Klrg1	T	A	6: 122,278,275	D66V	probably benign	Het
Llgl1	C	T	11: 60,709,724	A633V	probably benign	Het
Lmln	T	A	16: 33,074,097	Y203*	probably null	Het
Lrrc58	T	G	16: 37,877,056	C165G	probably benign	Het
Lss	T	C	10: 76,547,537	V557A	probably benign	Het
Mast4	T	C	13: 102,905,754		probably benign	Het
Med13l	C	A	5: 118,730,949	P754Q	possibly damaging	Het
Mga	C	T	2: 119,932,582	R1240*	probably null	Het
Mgat5b	T	A	11: 116,974,199		probably null	Het
Mtor	A	G	4: 148,525,752	D1572G	probably damaging	Het
Muc4	T	A	16: 32,754,214	S1363T	probably benign	Het
Muc4	T	A	16: 32,754,041	S1306T	probably benign	Het
Myo18b	A	G	5: 112,760,392	V2005A	probably damaging	Het
Myo1e	G	A	9: 70,353,272	D571N	probably benign	Het
Mypn	T	C	10: 63,119,968		probably null	Het
Ndufb10	T	C	17: 24,722,757		probably null	Het
Nelfb	G	T	2: 25,206,196	D300E	probably benign	Het
Olfr1389	T	A	11: 49,430,655	Y60N	probably damaging	Het
Olfr1507	A	T	14: 52,490,531	C61*	probably null	Het
Olfr625-ps1	T	A	7: 103,683,367	D206E	probably damaging	Het
Olfr668	T	A	7: 104,925,735	T10S	probably benign	Het
Pcdha11	C	T	18: 37,011,027	T57M	probably benign	Het
Pkp1	A	T	1: 135,880,855	I458N	possibly damaging	Het
Prr12	T	A	7: 45,051,229		probably benign	Het
Prrc2c	A	T	1: 162,705,310		probably benign	Het
Psd4	T	C	2: 24,397,247	F397S	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rfx1	T	A	8: 84,080,114		probably null	Het
Rsl1	A	G	13: 67,182,249	T254A	possibly damaging	Het
Sh3rf3	A	G	10: 59,086,824	Q574R	probably benign	Het
Spire1	T	C	18: 67,552,779		probably null	Het
St6galnac4	G	A	2: 32,594,063	G91D	probably damaging	Het
Sytl2	T	C	7: 90,382,257		probably benign	Het
Tbpl2	T	A	2: 24,093,860	K188N	possibly damaging	Het
Tenm3	A	T	8: 48,229,137	M2486K	possibly damaging	Het
Tgoln1	A	C	6: 72,616,140	V119G	possibly damaging	Het
Tpgs1	A	T	10: 79,669,491	N28Y	probably benign	Het
U2surp	A	C	9: 95,462,794		probably benign	Het
Vmn2r103	A	G	17: 19,773,511	H50R	probably benign	Het
Vmn2r19	A	G	6: 123,329,910	N459S	probably benign	Het
Vmn2r72	T	C	7: 85,738,485	S624G	probably damaging	Het
Vps13c	A	G	9: 67,919,321	T1415A	probably benign	Het
Vwa5b1	G	A	4: 138,608,843	P147S	probably damaging	Het

Other mutations in Crot

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00756:Crot	APN	5	8976072	missense	probably damaging	1.00
IGL01013:Crot	APN	5	8993575	missense	probably benign	0.06
IGL01085:Crot	APN	5	8973955	missense	probably damaging	1.00
IGL02017:Crot	APN	5	8970046	splice site	probably benign
IGL02306:Crot	APN	5	8968701	missense	possibly damaging	0.94
IGL02612:Crot	APN	5	8969945	missense	probably damaging	1.00
IGL02884:Crot	APN	5	8978197	critical splice donor site	probably null
IGL03091:Crot	APN	5	8966897	missense	probably benign
IGL03356:Crot	APN	5	8988295	splice site	probably benign
ouray	UTSW	5	8993504	critical splice donor site	probably null
R0383:Crot	UTSW	5	8968734	missense	probably damaging	1.00
R0396:Crot	UTSW	5	8969959	missense	probably damaging	1.00
R0502:Crot	UTSW	5	8976075	missense	possibly damaging	0.66
R0503:Crot	UTSW	5	8976075	missense	possibly damaging	0.66
R0676:Crot	UTSW	5	8993622	utr 5 prime	probably benign
R1079:Crot	UTSW	5	8993504	critical splice donor site	probably null
R1472:Crot	UTSW	5	8966941	missense	probably damaging	1.00
R1595:Crot	UTSW	5	8974186	missense	probably benign	0.00
R1757:Crot	UTSW	5	8987828	missense	probably damaging	1.00
R1828:Crot	UTSW	5	8969080	missense	probably benign	0.01
R1846:Crot	UTSW	5	8988248	missense	probably benign	0.36
R2142:Crot	UTSW	5	8987780	missense	possibly damaging	0.94
R3973:Crot	UTSW	5	8977541	missense	probably benign
R3974:Crot	UTSW	5	8977541	missense	probably benign
R3975:Crot	UTSW	5	8977541	missense	probably benign
R4445:Crot	UTSW	5	8973643	missense	probably damaging	1.00
R4446:Crot	UTSW	5	8973643	missense	probably damaging	1.00
R5084:Crot	UTSW	5	8969994	missense	probably damaging	1.00
R5464:Crot	UTSW	5	8983690	splice site	probably null
R5673:Crot	UTSW	5	8988131	missense	probably benign	0.00
R5814:Crot	UTSW	5	8973996	missense	probably damaging	0.99
R5935:Crot	UTSW	5	8974192	missense	probably benign
R5951:Crot	UTSW	5	8969120	nonsense	probably null
R6862:Crot	UTSW	5	8989641	missense	probably damaging	0.99
R6885:Crot	UTSW	5	8973635	missense	probably benign	0.00
R6983:Crot	UTSW	5	8978280	missense	probably benign	0.06
R7150:Crot	UTSW	5	8987878	missense	probably damaging	0.99
R7228:Crot	UTSW	5	8976051	missense	probably damaging	1.00
R7361:Crot	UTSW	5	8977534	missense	probably damaging	1.00
R7662:Crot	UTSW	5	8969072	missense	probably damaging	1.00
R7747:Crot	UTSW	5	8968869	critical splice donor site	probably null
R8002:Crot	UTSW	5	8993599	missense	probably benign	0.36
R8105:Crot	UTSW	5	8977505	missense	probably damaging	0.99
R8233:Crot	UTSW	5	8976027	missense	possibly damaging	0.77
R8474:Crot	UTSW	5	8993518	missense	probably damaging	1.00
R8519:Crot	UTSW	5	8973629	missense	probably benign
R8734:Crot	UTSW	5	8978208	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCTGCAGATCTGACGCCTAC -3'
(R):5'- GGTCATGGTGAACATTGCAC -3'

Sequencing Primer
(F):5'- TGAGAAATCATGGAAAAGCAAACTC -3'
(R):5'- GAGCAAGTCGTCATCCTT -3'

Posted On

2016-05-10