Incidental Mutation 'R4995:Etfdh'
ID385154
Institutional Source Beutler Lab
Gene Symbol Etfdh
Ensembl Gene ENSMUSG00000027809
Gene Nameelectron transferring flavoprotein, dehydrogenase
Synonyms0610010I20Rik
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79603788-79629500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79605788 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 376 (D376G)
Ref Sequence ENSEMBL: ENSMUSP00000113888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029382] [ENSMUST00000029386] [ENSMUST00000120992]
Predicted Effect probably benign
Transcript: ENSMUST00000029382
SMART Domains Protein: ENSMUSP00000029382
Gene: ENSMUSG00000027804

DomainStartEndE-ValueType
Pfam:Pro_isomerase 19 183 1.5e-49 PFAM
low complexity region 208 222 N/A INTRINSIC
TPR 223 256 1.78e-1 SMART
TPR 273 306 2.59e-3 SMART
TPR 307 340 2.82e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029386
AA Change: D436G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029386
Gene: ENSMUSG00000027809
AA Change: D436G

DomainStartEndE-ValueType
Pfam:Thi4 57 123 5.3e-9 PFAM
Pfam:FAD_binding_2 69 120 1.7e-7 PFAM
Pfam:Lycopene_cycl 69 125 5.7e-8 PFAM
Pfam:NAD_binding_8 72 122 9.7e-8 PFAM
Pfam:ETF_QO 511 614 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120992
AA Change: D376G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113888
Gene: ENSMUSG00000027809
AA Change: D376G

DomainStartEndE-ValueType
Pfam:Thi4 1 63 2e-8 PFAM
Pfam:FAD_binding_2 9 59 4.7e-8 PFAM
Pfam:Pyr_redox_2 9 209 1.7e-7 PFAM
Pfam:NAD_binding_9 11 56 2.1e-7 PFAM
Pfam:NAD_binding_8 12 61 2.8e-8 PFAM
Pfam:ETF_QO 402 511 3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195767
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the electron-transfer system in mitochondria and is essential for electron transfer from a number of mitochondrial flavin-containing dehydrogenases to the main respiratory chain. Mutations in this gene are associated with glutaric acidemia. Alternatively spliced transcript variants that encode distinct isoforms have been observed. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Etfdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Etfdh APN 3 79612061 splice site probably benign
IGL02231:Etfdh APN 3 79618393 missense probably damaging 1.00
IGL02414:Etfdh APN 3 79604096 missense probably damaging 0.99
IGL02816:Etfdh APN 3 79622805 missense probably damaging 1.00
PIT4142001:Etfdh UTSW 3 79609867 missense probably damaging 1.00
R0329:Etfdh UTSW 3 79609844 missense probably benign
R0555:Etfdh UTSW 3 79605805 missense probably benign 0.01
R2255:Etfdh UTSW 3 79604042 missense probably benign 0.10
R3040:Etfdh UTSW 3 79604919 missense probably damaging 1.00
R4035:Etfdh UTSW 3 79613711 missense probably benign 0.01
R4064:Etfdh UTSW 3 79605791 missense possibly damaging 0.90
R4693:Etfdh UTSW 3 79605803 missense probably damaging 0.97
R5079:Etfdh UTSW 3 79618398 missense probably damaging 1.00
R5138:Etfdh UTSW 3 79623573 missense probably benign 0.31
R5756:Etfdh UTSW 3 79613756 missense probably benign
R5762:Etfdh UTSW 3 79615954 missense probably null 1.00
R5824:Etfdh UTSW 3 79609945 missense probably damaging 1.00
R5906:Etfdh UTSW 3 79604115 missense probably damaging 1.00
R6165:Etfdh UTSW 3 79604944 missense probably benign
R6185:Etfdh UTSW 3 79605807 missense probably benign 0.00
R6228:Etfdh UTSW 3 79612029 nonsense probably null
R6993:Etfdh UTSW 3 79612031 missense probably benign 0.43
R7559:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7560:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7562:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7937:Etfdh UTSW 3 79609816 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCCTGAGGTTCCTAACACTACC -3'
(R):5'- TGTGCATAAAGCCCCAGTGC -3'

Sequencing Primer
(F):5'- GTTCCTAACACTACCAAAAAGGGGG -3'
(R):5'- AGCCCCAGTGCCAGCAC -3'
Posted On2016-05-10