Incidental Mutation 'R4995:Acvrl1'
ID385211
Institutional Source Beutler Lab
Gene Symbol Acvrl1
Ensembl Gene ENSMUSG00000000530
Gene Nameactivin A receptor, type II-like 1
SynonymsAlk-1, activin receptor-like kinase-1, Alk1, Acvrlk1
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101128522-101145336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101135860 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 141 (R141H)
Ref Sequence ENSEMBL: ENSMUSP00000112490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000542] [ENSMUST00000117984] [ENSMUST00000119063] [ENSMUST00000120028] [ENSMUST00000120754] [ENSMUST00000121718] [ENSMUST00000124151] [ENSMUST00000130432] [ENSMUST00000144229]
Predicted Effect probably benign
Transcript: ENSMUST00000000542
AA Change: R141H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000542
Gene: ENSMUSG00000000530
AA Change: R141H

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117984
AA Change: R141H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113505
Gene: ENSMUSG00000000530
AA Change: R141H

DomainStartEndE-ValueType
PDB:2LCR|A 19 116 4e-43 PDB
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119063
AA Change: R141H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113536
Gene: ENSMUSG00000000530
AA Change: R141H

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120028
AA Change: R141H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113297
Gene: ENSMUSG00000000530
AA Change: R141H

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120754
AA Change: R141H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112490
Gene: ENSMUSG00000000530
AA Change: R141H

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121718
AA Change: R141H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114027
Gene: ENSMUSG00000000530
AA Change: R141H

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124151
SMART Domains Protein: ENSMUSP00000114829
Gene: ENSMUSG00000000530

DomainStartEndE-ValueType
PDB:2LCR|A 19 76 8e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128868
Predicted Effect probably benign
Transcript: ENSMUST00000130432
Predicted Effect probably benign
Transcript: ENSMUST00000144229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153253
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die at midgestation with severe vascular abnormalities, including fusion of major arteries and veins. Mice heterozygous for one targeted mutation provide a suitable model for hereditary hemorrhagic telangiectasia type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Acvrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Acvrl1 APN 15 101143340 splice site probably null
IGL00780:Acvrl1 APN 15 101137367 missense probably damaging 1.00
IGL01714:Acvrl1 APN 15 101137370 missense probably damaging 1.00
IGL02962:Acvrl1 APN 15 101135501 missense probably benign 0.00
IGL03268:Acvrl1 APN 15 101135922 missense possibly damaging 0.48
IGL03341:Acvrl1 APN 15 101137596 missense probably damaging 1.00
R0256:Acvrl1 UTSW 15 101137121 missense probably damaging 1.00
R0538:Acvrl1 UTSW 15 101136149 missense probably damaging 0.99
R1666:Acvrl1 UTSW 15 101137577 missense probably damaging 1.00
R2402:Acvrl1 UTSW 15 101137399 missense probably damaging 1.00
R3789:Acvrl1 UTSW 15 101137469 missense probably damaging 0.98
R4720:Acvrl1 UTSW 15 101135773 missense probably damaging 1.00
R4844:Acvrl1 UTSW 15 101135528 missense probably damaging 0.98
R5053:Acvrl1 UTSW 15 101137369 missense probably damaging 1.00
R5093:Acvrl1 UTSW 15 101134747 splice site probably null
R5191:Acvrl1 UTSW 15 101137065 missense probably damaging 0.99
R6981:Acvrl1 UTSW 15 101138345 missense probably damaging 1.00
R7224:Acvrl1 UTSW 15 101143364 missense probably benign 0.17
R7231:Acvrl1 UTSW 15 101136223 nonsense probably null
R7326:Acvrl1 UTSW 15 101141072 missense probably damaging 0.97
R7555:Acvrl1 UTSW 15 101143473 missense probably benign 0.05
R7569:Acvrl1 UTSW 15 101135755 missense probably benign 0.00
R7627:Acvrl1 UTSW 15 101135866 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGCTGGGATCTGACTGTAAGTAG -3'
(R):5'- ACAGCTTGGTCCTCACTGTC -3'

Sequencing Primer
(F):5'- ATCTGACTGTAAGTAGTCTGGCTCAG -3'
(R):5'- TCACTGTCATCATGGGTGAC -3'
Posted On2016-05-10