Incidental Mutation 'R4995:Mast4'
ID 385205
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Name microtubule associated serine/threonine kinase family member 4
Synonyms 4930420O11Rik
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # R4995 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 102868994-103471005 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 103042262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000164111] [ENSMUST00000166336] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]
AlphaFold Q811L6
Predicted Effect probably benign
Transcript: ENSMUST00000099202
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164111
SMART Domains Protein: ENSMUSP00000126625
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166336
SMART Domains Protein: ENSMUSP00000126516
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 71 212 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166867
Predicted Effect probably benign
Transcript: ENSMUST00000167058
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171791
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172264
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194446
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Celsr1 C A 15: 85,822,112 (GRCm39) R1735L probably damaging Het
Cep250 A G 2: 155,830,236 (GRCm39) D135G probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Ehbp1 T A 11: 22,051,073 (GRCm39) H493L probably damaging Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Fgf11 G A 11: 69,689,585 (GRCm39) H138Y probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mga C T 2: 119,763,063 (GRCm39) R1240* probably null Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nelfb G T 2: 25,096,208 (GRCm39) D300E probably benign Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tgoln1 A C 6: 72,593,123 (GRCm39) V119G possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102,907,275 (GRCm39) nonsense probably null
IGL00933:Mast4 APN 13 102,871,874 (GRCm39) missense probably damaging 0.97
IGL01113:Mast4 APN 13 102,910,744 (GRCm39) missense probably damaging 1.00
IGL01461:Mast4 APN 13 102,890,576 (GRCm39) missense probably damaging 1.00
IGL01569:Mast4 APN 13 102,897,523 (GRCm39) missense probably damaging 1.00
IGL01697:Mast4 APN 13 102,904,401 (GRCm39) missense probably damaging 1.00
IGL01725:Mast4 APN 13 102,887,020 (GRCm39) critical splice donor site probably null
IGL01734:Mast4 APN 13 102,874,123 (GRCm39) missense probably damaging 0.98
IGL01738:Mast4 APN 13 102,873,749 (GRCm39) missense probably damaging 1.00
IGL01739:Mast4 APN 13 102,910,781 (GRCm39) missense probably damaging 1.00
IGL02299:Mast4 APN 13 102,874,482 (GRCm39) missense probably benign 0.44
IGL02479:Mast4 APN 13 102,878,545 (GRCm39) missense probably damaging 1.00
IGL02485:Mast4 APN 13 102,872,004 (GRCm39) missense probably benign 0.02
IGL02528:Mast4 APN 13 102,990,331 (GRCm39) makesense probably null
IGL02850:Mast4 APN 13 102,890,740 (GRCm39) missense probably damaging 1.00
IGL02900:Mast4 APN 13 102,872,184 (GRCm39) missense probably benign
IGL03064:Mast4 APN 13 102,897,472 (GRCm39) nonsense probably null
IGL03124:Mast4 APN 13 102,874,753 (GRCm39) missense probably damaging 1.00
IGL03146:Mast4 APN 13 102,874,163 (GRCm39) missense probably benign 0.00
IGL03221:Mast4 APN 13 102,890,764 (GRCm39) missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102,887,905 (GRCm39) missense probably damaging 1.00
IGL03406:Mast4 APN 13 102,873,615 (GRCm39) missense possibly damaging 0.46
buck UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
doe UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
skinnybones UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
BB010:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
BB020:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102,871,370 (GRCm39) utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102,872,825 (GRCm39) small insertion probably benign
FR4340:Mast4 UTSW 13 102,871,365 (GRCm39) frame shift probably null
FR4548:Mast4 UTSW 13 102,872,826 (GRCm39) small insertion probably benign
FR4976:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
FR4976:Mast4 UTSW 13 102,872,820 (GRCm39) small insertion probably benign
NA:Mast4 UTSW 13 102,878,565 (GRCm39) missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
R0009:Mast4 UTSW 13 102,878,566 (GRCm39) missense probably damaging 1.00
R0063:Mast4 UTSW 13 103,470,723 (GRCm39) start gained probably benign
R0242:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R0310:Mast4 UTSW 13 102,890,669 (GRCm39) missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102,871,781 (GRCm39) missense probably damaging 1.00
R0454:Mast4 UTSW 13 102,888,068 (GRCm39) missense probably damaging 1.00
R0646:Mast4 UTSW 13 102,895,252 (GRCm39) splice site probably benign
R0744:Mast4 UTSW 13 102,873,895 (GRCm39) missense probably damaging 0.98
R0883:Mast4 UTSW 13 102,990,408 (GRCm39) missense probably damaging 1.00
R0905:Mast4 UTSW 13 102,907,292 (GRCm39) missense probably damaging 0.99
R1023:Mast4 UTSW 13 102,872,004 (GRCm39) missense probably benign 0.02
R1281:Mast4 UTSW 13 102,887,086 (GRCm39) missense probably damaging 1.00
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102,909,027 (GRCm39) missense probably damaging 1.00
R1572:Mast4 UTSW 13 102,873,431 (GRCm39) missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102,875,771 (GRCm39) missense probably damaging 1.00
R1865:Mast4 UTSW 13 102,930,625 (GRCm39) missense probably damaging 1.00
R2050:Mast4 UTSW 13 102,887,917 (GRCm39) missense probably damaging 1.00
R2060:Mast4 UTSW 13 102,875,354 (GRCm39) missense probably damaging 1.00
R2062:Mast4 UTSW 13 102,895,601 (GRCm39) missense probably benign 0.18
R2106:Mast4 UTSW 13 102,887,054 (GRCm39) missense probably damaging 1.00
R2118:Mast4 UTSW 13 102,890,713 (GRCm39) missense probably damaging 1.00
R2143:Mast4 UTSW 13 102,871,983 (GRCm39) missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102,872,259 (GRCm39) missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102,934,715 (GRCm39) splice site probably benign
R2370:Mast4 UTSW 13 102,910,695 (GRCm39) missense probably damaging 1.00
R2504:Mast4 UTSW 13 102,875,147 (GRCm39) missense probably damaging 0.96
R2509:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R2842:Mast4 UTSW 13 102,872,939 (GRCm39) missense probably benign 0.01
R3087:Mast4 UTSW 13 102,990,434 (GRCm39) splice site probably benign
R3434:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3435:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3763:Mast4 UTSW 13 102,923,927 (GRCm39) missense probably damaging 1.00
R3826:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3829:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3830:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3913:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R3914:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4021:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4022:Mast4 UTSW 13 102,990,377 (GRCm39) missense probably damaging 1.00
R4022:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4210:Mast4 UTSW 13 102,875,713 (GRCm39) missense probably damaging 1.00
R4342:Mast4 UTSW 13 102,910,756 (GRCm39) missense probably damaging 1.00
R4580:Mast4 UTSW 13 102,873,766 (GRCm39) nonsense probably null
R4627:Mast4 UTSW 13 103,470,529 (GRCm39) missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103,470,627 (GRCm39) missense probably benign 0.01
R4732:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4733:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4833:Mast4 UTSW 13 102,910,692 (GRCm39) critical splice donor site probably null
R5059:Mast4 UTSW 13 102,887,071 (GRCm39) missense probably damaging 1.00
R5073:Mast4 UTSW 13 102,875,391 (GRCm39) nonsense probably null
R5101:Mast4 UTSW 13 102,872,864 (GRCm39) missense probably benign 0.01
R5526:Mast4 UTSW 13 102,890,723 (GRCm39) missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102,873,987 (GRCm39) missense probably damaging 1.00
R5673:Mast4 UTSW 13 102,930,580 (GRCm39) missense probably damaging 1.00
R5694:Mast4 UTSW 13 102,910,701 (GRCm39) nonsense probably null
R5906:Mast4 UTSW 13 102,872,252 (GRCm39) missense probably benign 0.31
R5908:Mast4 UTSW 13 102,874,764 (GRCm39) missense probably damaging 1.00
R5947:Mast4 UTSW 13 102,872,148 (GRCm39) missense probably benign
R5987:Mast4 UTSW 13 102,895,242 (GRCm39) missense probably damaging 1.00
R6143:Mast4 UTSW 13 102,990,391 (GRCm39) missense probably damaging 1.00
R6154:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6169:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6239:Mast4 UTSW 13 102,872,717 (GRCm39) missense probably benign 0.01
R6327:Mast4 UTSW 13 102,897,890 (GRCm39) missense probably damaging 1.00
R6356:Mast4 UTSW 13 102,872,493 (GRCm39) missense possibly damaging 0.80
R6432:Mast4 UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
R6667:Mast4 UTSW 13 102,874,004 (GRCm39) missense probably damaging 1.00
R6941:Mast4 UTSW 13 102,941,222 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,934,586 (GRCm39) missense probably damaging 1.00
R6970:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6980:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6991:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6992:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6993:Mast4 UTSW 13 102,872,482 (GRCm39) missense probably benign 0.28
R6993:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R7083:Mast4 UTSW 13 102,874,223 (GRCm39) missense probably damaging 1.00
R7241:Mast4 UTSW 13 103,470,508 (GRCm39) missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102,874,986 (GRCm39) missense probably damaging 1.00
R7246:Mast4 UTSW 13 102,930,511 (GRCm39) missense probably damaging 1.00
R7332:Mast4 UTSW 13 102,887,932 (GRCm39) missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
R7514:Mast4 UTSW 13 102,923,934 (GRCm39) nonsense probably null
R7697:Mast4 UTSW 13 102,875,711 (GRCm39) missense probably damaging 1.00
R7820:Mast4 UTSW 13 102,890,596 (GRCm39) missense probably damaging 1.00
R7874:Mast4 UTSW 13 102,875,783 (GRCm39) missense probably damaging 1.00
R7933:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
R8042:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.96
R8060:Mast4 UTSW 13 102,874,184 (GRCm39) missense possibly damaging 0.89
R8172:Mast4 UTSW 13 103,089,633 (GRCm39) critical splice donor site probably null
R8206:Mast4 UTSW 13 102,872,247 (GRCm39) missense probably damaging 1.00
R8248:Mast4 UTSW 13 102,875,229 (GRCm39) missense probably damaging 1.00
R8283:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R8346:Mast4 UTSW 13 102,887,986 (GRCm39) missense probably damaging 0.99
R8434:Mast4 UTSW 13 102,897,900 (GRCm39) missense probably damaging 1.00
R8796:Mast4 UTSW 13 102,919,899 (GRCm39) missense probably benign 0.07
R8850:Mast4 UTSW 13 102,895,174 (GRCm39) missense probably damaging 1.00
R9012:Mast4 UTSW 13 102,934,606 (GRCm39) missense probably benign 0.05
R9375:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.99
R9389:Mast4 UTSW 13 103,470,438 (GRCm39) missense probably benign 0.00
R9404:Mast4 UTSW 13 102,887,933 (GRCm39) missense probably damaging 1.00
R9520:Mast4 UTSW 13 102,925,532 (GRCm39) missense probably damaging 1.00
R9525:Mast4 UTSW 13 102,872,944 (GRCm39) missense probably benign 0.00
R9526:Mast4 UTSW 13 102,873,593 (GRCm39) missense probably benign 0.00
R9709:Mast4 UTSW 13 102,910,711 (GRCm39) missense probably damaging 1.00
R9790:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
R9791:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
RF005:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF015:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
RF019:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF037:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF039:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF040:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
Z1088:Mast4 UTSW 13 102,875,027 (GRCm39) missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102,874,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACAAACTTTTCAAACTGCC -3'
(R):5'- GCACGGGAAGGGTAATTCTCAG -3'

Sequencing Primer
(F):5'- ATCCCAGACGCAACCGGG -3'
(R):5'- TCTCTGAAGGGAGTGAGT -3'
Posted On 2016-05-10