Incidental Mutation 'R5010:Slc1a3'
ID390456
Institutional Source Beutler Lab
Gene Symbol Slc1a3
Ensembl Gene ENSMUSG00000005360
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 3
SynonymsGLAST, MGluT1, Gmt1, B430115D02Rik, Eaat1
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8634124-8710764 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 8650846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005493]
Predicted Effect probably benign
Transcript: ENSMUST00000005493
SMART Domains Protein: ENSMUSP00000005493
Gene: ENSMUSG00000005360

DomainStartEndE-ValueType
Pfam:SDF 50 497 8.5e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195237
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a member of a high affinity glutamate transporter family. This gene functions in the termination of excitatory neurotransmission in central nervous system. Mutations are associated with episodic ataxia, Type 6. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormalities with respect to appearance or survival but do display functional abnormalities related to the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Slc1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Slc1a3 APN 15 8645687 missense probably damaging 1.00
IGL01133:Slc1a3 APN 15 8650993 missense probably damaging 1.00
IGL01696:Slc1a3 APN 15 8642338 missense probably benign 0.19
IGL03108:Slc1a3 APN 15 8639078 missense probably damaging 1.00
R0128:Slc1a3 UTSW 15 8636209 missense probably benign 0.07
R0206:Slc1a3 UTSW 15 8708556 splice site probably benign
R0312:Slc1a3 UTSW 15 8636237 missense probably benign 0.00
R0385:Slc1a3 UTSW 15 8639135 missense probably damaging 1.00
R0538:Slc1a3 UTSW 15 8650922 missense probably benign
R0579:Slc1a3 UTSW 15 8688309 missense probably damaging 0.98
R1799:Slc1a3 UTSW 15 8688404 missense probably damaging 1.00
R2029:Slc1a3 UTSW 15 8645669 missense probably benign 0.29
R3236:Slc1a3 UTSW 15 8639123 missense probably damaging 0.98
R4494:Slc1a3 UTSW 15 8639095 missense probably damaging 1.00
R5154:Slc1a3 UTSW 15 8642949 missense probably benign 0.09
R5226:Slc1a3 UTSW 15 8642225 missense probably damaging 1.00
R5538:Slc1a3 UTSW 15 8645704 missense probably damaging 0.99
R6049:Slc1a3 UTSW 15 8645693 missense probably damaging 1.00
R6072:Slc1a3 UTSW 15 8708568 missense probably damaging 0.99
R6496:Slc1a3 UTSW 15 8649581 missense probably benign 0.01
R7015:Slc1a3 UTSW 15 8649568 missense probably damaging 1.00
R7168:Slc1a3 UTSW 15 8645902 missense possibly damaging 0.79
R7255:Slc1a3 UTSW 15 8642999 missense possibly damaging 0.90
R7476:Slc1a3 UTSW 15 8643084 missense probably damaging 0.99
R7732:Slc1a3 UTSW 15 8650988 missense probably benign 0.09
R8041:Slc1a3 UTSW 15 8636199 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCCAGATCAGCCACTTCATC -3'
(R):5'- GCCCTAGATAGTAAGGCATCCG -3'

Sequencing Primer
(F):5'- CATCATCTATGTGGGATCAGAAGAC -3'
(R):5'- CCTAGATAGTAAGGCATCCGGGAAG -3'
Posted On2016-06-06