Incidental Mutation 'R5010:Dctd'
ID390441
Institutional Source Beutler Lab
Gene Symbol Dctd
Ensembl Gene ENSMUSG00000031562
Gene NamedCMP deaminase
Synonyms
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5010 (G1)
Quality Score201
Status Validated
Chromosome8
Chromosomal Location48099092-48153233 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 48137414 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033966] [ENSMUST00000170263] [ENSMUST00000174278] [ENSMUST00000174379] [ENSMUST00000174818]
Predicted Effect probably benign
Transcript: ENSMUST00000033966
SMART Domains Protein: ENSMUSP00000033966
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098773
Predicted Effect probably benign
Transcript: ENSMUST00000170263
SMART Domains Protein: ENSMUSP00000126733
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173991
Predicted Effect probably benign
Transcript: ENSMUST00000174278
SMART Domains Protein: ENSMUSP00000133445
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174379
SMART Domains Protein: ENSMUSP00000134195
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 103 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174818
SMART Domains Protein: ENSMUSP00000134003
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 131 1.5e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the deamination of dCMP to dUMP, the nucleotide substrate for thymidylate synthase. The encoded protein is allosterically activated by dCTP and inhibited by dTTP, and is found as a homohexamer. This protein uses zinc as a cofactor for its activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Dctd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Dctd APN 8 48111662 start gained probably benign
R0194:Dctd UTSW 8 48112078 missense probably benign 0.01
R4871:Dctd UTSW 8 48137414 intron probably benign
R5007:Dctd UTSW 8 48137414 intron probably benign
R5008:Dctd UTSW 8 48137414 intron probably benign
R5009:Dctd UTSW 8 48137414 intron probably benign
R5083:Dctd UTSW 8 48111716 missense probably damaging 1.00
R5381:Dctd UTSW 8 48137414 intron probably benign
R5382:Dctd UTSW 8 48137414 intron probably benign
R7131:Dctd UTSW 8 48112040 missense probably benign 0.02
R8152:Dctd UTSW 8 48111690 missense probably benign
X0057:Dctd UTSW 8 48140360 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTATTTCCAAGGTGGTGAC -3'
(R):5'- TTAAGTCTCGGAATACCTGGC -3'

Sequencing Primer
(F):5'- TTCATGAGCTACAGTCCAAGTC -3'
(R):5'- GTCTCGGAATACCTGGCACCAC -3'
Posted On2016-06-06