Mutagenetix > Incidental Mutations

Incidental Mutation 'R5418:Plxnb2'

427881

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

042986-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R5418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89166491 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 421 (Y421H)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

Predicted Effect

probably benign
Transcript: ENSMUST00000060808
AA Change: Y421H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: Y421H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109331
AA Change: Y421H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: Y421H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Meta Mutation Damage Score

0.1357

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	C	6: 149,326,136	Y227H	probably damaging	Het
4930568D16Rik	A	G	2: 35,354,726	S205P	probably damaging	Het
9530077C05Rik	G	T	9: 22,431,770	R187L	probably damaging	Het
Abcc1	T	C	16: 14,461,132	V1102A	probably benign	Het
Acad8	A	T	9: 26,985,557	M202K	probably damaging	Het
Acoxl	T	A	2: 127,877,802	M161K	probably benign	Het
Adamts4	T	A	1: 171,252,574	V35E	probably damaging	Het
Add2	A	G	6: 86,110,912	S614G	probably benign	Het
Adgrv1	T	A	13: 81,419,308	I5249L	probably benign	Het
Agps	A	G	2: 75,858,904	T252A	probably damaging	Het
Alms1-ps1	G	A	6: 85,755,602		noncoding transcript	Het
Ankrd24	T	A	10: 81,644,942		probably benign	Het
Bcl9l	A	G	9: 44,505,436	Q218R	possibly damaging	Het
Bin2	T	C	15: 100,649,146	Y232C	probably damaging	Het
Bptf	A	G	11: 107,111,294	Y331H	probably damaging	Het
Ccr10	C	T	11: 101,174,078	V209M	probably benign	Het
Cflar	A	T	1: 58,752,651	D371V	possibly damaging	Het
Col1a2	A	G	6: 4,516,931		probably benign	Het
Crlf2	A	G	5: 109,557,033	V104A	probably benign	Het
Dennd1c	CCGCCCCTCGCTGACAGC	CC	17: 57,066,755		probably null	Het
Dmxl2	A	G	9: 54,374,651		probably null	Het
Dnah17	C	A	11: 118,094,984	E1422D	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Efcab11	A	G	12: 99,855,618	L80S	possibly damaging	Het
Emc8	G	A	8: 120,658,603	T130M	probably damaging	Het
Epha6	C	A	16: 60,424,835	A334S	possibly damaging	Het
Erc2	A	G	14: 27,966,510	M196V	probably benign	Het
Etnk2	T	C	1: 133,373,257	I254T	probably damaging	Het
Fam120b	C	T	17: 15,401,799	T13M	probably damaging	Het
Fam234b	A	G	6: 135,226,968	K423E	probably benign	Het
Fcgbp	G	A	7: 28,085,313	G266D	probably damaging	Het
Fndc4	A	T	5: 31,294,634	S146R	probably benign	Het
Frmd3	G	A	4: 74,161,698		probably null	Het
Glrx2	C	A	1: 143,739,708	S16R	possibly damaging	Het
Gm26526	T	G	7: 39,588,934		noncoding transcript	Het
Hc	C	T	2: 35,008,183		probably null	Het
Herc2	T	C	7: 56,137,565	C1695R	probably damaging	Het
Hic1	A	G	11: 75,166,599		probably null	Het
Igkv4-92	A	T	6: 68,755,580	V5E	possibly damaging	Het
Irs1	G	A	1: 82,288,770	T575I	probably damaging	Het
Kcp	A	T	6: 29,504,284	Y143*	probably null	Het
Klb	A	G	5: 65,383,470	N969D	probably benign	Het
Klra6	T	A	6: 130,013,430	L239F	probably damaging	Het
Lhx6	A	G	2: 36,087,366		probably null	Het
Lrrc34	G	A	3: 30,642,774	P116S	possibly damaging	Het
Map3k9	T	A	12: 81,743,817	K321*	probably null	Het
Mapk14	T	C	17: 28,741,843	V196A	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Mtmr12	T	C	15: 12,269,959	L711P	probably damaging	Het
Mylk	T	C	16: 34,912,230	S627P	probably benign	Het
Nbea	A	T	3: 55,645,989	Y2631N	possibly damaging	Het
Ncoa7	A	G	10: 30,648,039	V153A	probably damaging	Het
Olfr1252	T	C	2: 89,721,999	I37M	probably benign	Het
Pax6	A	T	2: 105,691,565	D175V	probably benign	Het
Piezo1	A	G	8: 122,486,780	L1793P	probably damaging	Het
Pkp4	T	C	2: 59,310,162	V404A	probably benign	Het
Prkdc	T	G	16: 15,795,097	V3173G	probably benign	Het
Prss40	A	T	1: 34,560,759	I49N	probably benign	Het
Prx	T	A	7: 27,517,274	V400E	probably damaging	Het
Rbm11	A	C	16: 75,596,535	T40P	probably damaging	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Sema3f	A	G	9: 107,692,621	Y70H	probably damaging	Het
Senp6	G	A	9: 80,121,869	E505K	possibly damaging	Het
Slc25a3	T	C	10: 91,119,536	I147M	probably benign	Het
Slc4a7	T	A	14: 14,760,280	S572T	probably benign	Het
Smarcal1	C	T	1: 72,598,909	P501S	probably benign	Het
Sox7	C	T	14: 63,947,947	T144M	probably benign	Het
Taar1	T	C	10: 23,921,316	F304S	possibly damaging	Het
Tcf3	A	G	10: 80,427,683	F46L	probably damaging	Het
Tmem184c	A	G	8: 77,597,820	V347A	probably damaging	Het
Tpcn2	C	T	7: 145,278,781	E113K	probably damaging	Het
Vmn1r232	T	A	17: 20,914,116	Y74F	possibly damaging	Het
Vmn2r102	C	T	17: 19,694,153	T660I	probably damaging	Het
Zdhhc3	A	G	9: 123,080,391	M234T	probably damaging	Het
Zfp960	T	A	17: 17,087,543	L173H	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGGTGCTATGAAGACTCAGAGAC -3'
(R):5'- AATCTGACAGCAGTGACAGTAAC -3'

Sequencing Primer
(F):5'- GAGACAGGAGCCCAGACTC -3'
(R):5'- TGACAGTAACTGCCGAGAATGACC -3'

Posted On

2016-09-01